FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633490_at:

>probe:Drosophila_2:1633490_at:393:109; Interrogation_Position=110; Antisense; AGCAATGGCCTCGACCAGACGGAGG
>probe:Drosophila_2:1633490_at:528:435; Interrogation_Position=131; Antisense; GAGGAGTCCGACACTCGTCTGGCTG
>probe:Drosophila_2:1633490_at:189:591; Interrogation_Position=162; Antisense; TGGTCACCCAAAGGAACCTCCAATT
>probe:Drosophila_2:1633490_at:188:419; Interrogation_Position=219; Antisense; GAGCTCGTCGAGATGCCACCGGCTT
>probe:Drosophila_2:1633490_at:303:629; Interrogation_Position=248; Antisense; TCCAACCAGGAGGTGCGGCTAAAAG
>probe:Drosophila_2:1633490_at:644:661; Interrogation_Position=267; Antisense; TAAAAGCCGGCGACATGCGCATGGC
>probe:Drosophila_2:1633490_at:391:253; Interrogation_Position=343; Antisense; CAAGCAGCTGAAGGACCTCTGCCAG
>probe:Drosophila_2:1633490_at:112:281; Interrogation_Position=359; Antisense; CTCTGCCAGCAGGTGCGGTTGAATG
>probe:Drosophila_2:1633490_at:87:537; Interrogation_Position=400; Antisense; GGTCCTGGCTGAAGAATTCCTTTGC
>probe:Drosophila_2:1633490_at:543:139; Interrogation_Position=43; Antisense; ACGGAGATTATAATCCACCGCCCAA
>probe:Drosophila_2:1633490_at:318:37; Interrogation_Position=434; Antisense; ATCATTCGGTTTAGGTGGTGCCAAA
>probe:Drosophila_2:1633490_at:465:535; Interrogation_Position=450; Antisense; GGTGCCAAATTCAAGTGCTAACGAT
>probe:Drosophila_2:1633490_at:363:133; Interrogation_Position=59; Antisense; ACCGCCCAAGCTAGAATGCCGGAAA
>probe:Drosophila_2:1633490_at:727:551; Interrogation_Position=79; Antisense; GGAAACGAAACCCAAGACGCACTGC

Paste this into a BLAST search page for me
AGCAATGGCCTCGACCAGACGGAGGGAGGAGTCCGACACTCGTCTGGCTGTGGTCACCCAAAGGAACCTCCAATTGAGCTCGTCGAGATGCCACCGGCTTTCCAACCAGGAGGTGCGGCTAAAAGTAAAAGCCGGCGACATGCGCATGGCCAAGCAGCTGAAGGACCTCTGCCAGCTCTGCCAGCAGGTGCGGTTGAATGGGTCCTGGCTGAAGAATTCCTTTGCACGGAGATTATAATCCACCGCCCAAATCATTCGGTTTAGGTGGTGCCAAAGGTGCCAAATTCAAGTGCTAACGATACCGCCCAAGCTAGAATGCCGGAAAGGAAACGAAACCCAAGACGCACTGC

Full Affymetrix probeset data:

Annotations for 1633490_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720