Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633491_s_at:

>probe:Drosophila_2:1633491_s_at:698:111; Interrogation_Position=509; Antisense; AGCAACAGCTTCAGTCGCAGCGGTA
>probe:Drosophila_2:1633491_s_at:25:409; Interrogation_Position=559; Antisense; GACGCGGGATTCATTATGGGACGAT
>probe:Drosophila_2:1633491_s_at:208:139; Interrogation_Position=579; Antisense; ACGATTTCTGATCGGTGCCTGGGAA
>probe:Drosophila_2:1633491_s_at:664:165; Interrogation_Position=602; Antisense; AAATCGGACTTGTCTCCGTGGACGA
>probe:Drosophila_2:1633491_s_at:634:229; Interrogation_Position=628; Antisense; AATGTCGCCGAGTACGTTGCCATGG
>probe:Drosophila_2:1633491_s_at:681:577; Interrogation_Position=651; Antisense; GGCCGTGCAAGTTCTGCTCAAGGAT
>probe:Drosophila_2:1633491_s_at:674:337; Interrogation_Position=666; Antisense; GCTCAAGGATCTACTATCGGCAATC
>probe:Drosophila_2:1633491_s_at:500:667; Interrogation_Position=736; Antisense; TACTACGATGTAGGTGCTCCGTTGC
>probe:Drosophila_2:1633491_s_at:711:221; Interrogation_Position=796; Antisense; AAGGTCGACGACACGCCGCTGGAAC
>probe:Drosophila_2:1633491_s_at:312:29; Interrogation_Position=836; Antisense; ATACGGCCAACTTTATGCGGCGACA
>probe:Drosophila_2:1633491_s_at:323:153; Interrogation_Position=858; Antisense; ACAGAACGACGATGTGACCTTCCTC
>probe:Drosophila_2:1633491_s_at:232:379; Interrogation_Position=910; Antisense; GAACGCACAGTAATCACCCTCAAGG
>probe:Drosophila_2:1633491_s_at:154:75; Interrogation_Position=932; Antisense; AGGACTGCCAACTGGCCTTACGGGA
>probe:Drosophila_2:1633491_s_at:110:669; Interrogation_Position=950; Antisense; TACGGGATCGCAACCTGATAGGCTC

Paste this into a BLAST search page for me
AGCAACAGCTTCAGTCGCAGCGGTAGACGCGGGATTCATTATGGGACGATACGATTTCTGATCGGTGCCTGGGAAAAATCGGACTTGTCTCCGTGGACGAAATGTCGCCGAGTACGTTGCCATGGGGCCGTGCAAGTTCTGCTCAAGGATGCTCAAGGATCTACTATCGGCAATCTACTACGATGTAGGTGCTCCGTTGCAAGGTCGACGACACGCCGCTGGAACATACGGCCAACTTTATGCGGCGACAACAGAACGACGATGTGACCTTCCTCGAACGCACAGTAATCACCCTCAAGGAGGACTGCCAACTGGCCTTACGGGATACGGGATCGCAACCTGATAGGCTC

Full Affymetrix probeset data:

Annotations for 1633491_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime