FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633492_at:

>probe:Drosophila_2:1633492_at:608:129; Interrogation_Position=1007; Antisense; ACCCCGTTGGTCAGTGCAGGAGCAC
>probe:Drosophila_2:1633492_at:373:417; Interrogation_Position=1067; Antisense; GAGCGAGTTCATGGGCCTAATTCTG
>probe:Drosophila_2:1633492_at:381:607; Interrogation_Position=1150; Antisense; TGATGACGCCACATGGTCCAGATGT
>probe:Drosophila_2:1633492_at:530:723; Interrogation_Position=1183; Antisense; TTGAAGGTGCCTCGAATGCCAAACT
>probe:Drosophila_2:1633492_at:653:43; Interrogation_Position=1198; Antisense; ATGCCAAACTGGTGCCGGAACGCGT
>probe:Drosophila_2:1633492_at:648:561; Interrogation_Position=1230; Antisense; GGAACTCAGGCCTTCATGTTCGAAT
>probe:Drosophila_2:1633492_at:495:367; Interrogation_Position=1251; Antisense; GAATCCTCTCTAAGTTTGGCCGTTA
>probe:Drosophila_2:1633492_at:187:689; Interrogation_Position=1317; Antisense; TATTACGAATGCTGGCAGGCGCTGA
>probe:Drosophila_2:1633492_at:710:191; Interrogation_Position=861; Antisense; AACTATGTGCCCTTCAAGTACGATC
>probe:Drosophila_2:1633492_at:716:217; Interrogation_Position=876; Antisense; AAGTACGATCTGTCCAAGTTCATGG
>probe:Drosophila_2:1633492_at:332:475; Interrogation_Position=912; Antisense; GTTAGCTTTGACCATTGTGACCCCA
>probe:Drosophila_2:1633492_at:87:717; Interrogation_Position=926; Antisense; TTGTGACCCCAGCATTTTTACCGTG
>probe:Drosophila_2:1633492_at:542:119; Interrogation_Position=971; Antisense; AGCTGGAACGGCCATAGCAGACTTT
>probe:Drosophila_2:1633492_at:401:111; Interrogation_Position=986; Antisense; AGCAGACTTTGTGATCTTTCCACCC

Paste this into a BLAST search page for me
ACCCCGTTGGTCAGTGCAGGAGCACGAGCGAGTTCATGGGCCTAATTCTGTGATGACGCCACATGGTCCAGATGTTTGAAGGTGCCTCGAATGCCAAACTATGCCAAACTGGTGCCGGAACGCGTGGAACTCAGGCCTTCATGTTCGAATGAATCCTCTCTAAGTTTGGCCGTTATATTACGAATGCTGGCAGGCGCTGAAACTATGTGCCCTTCAAGTACGATCAAGTACGATCTGTCCAAGTTCATGGGTTAGCTTTGACCATTGTGACCCCATTGTGACCCCAGCATTTTTACCGTGAGCTGGAACGGCCATAGCAGACTTTAGCAGACTTTGTGATCTTTCCACCC

Full Affymetrix probeset data:

Annotations for 1633492_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720