FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633498_at:

>probe:Drosophila_2:1633498_at:699:343; Interrogation_Position=1004; Antisense; GCTTCCAGTATAAAATTCGATGTGA
>probe:Drosophila_2:1633498_at:590:669; Interrogation_Position=891; Antisense; TACTGACGCAAAAGCTCAAGACCTT
>probe:Drosophila_2:1633498_at:53:611; Interrogation_Position=894; Antisense; TGACGCAAAAGCTCAAGACCTTCAT
>probe:Drosophila_2:1633498_at:628:101; Interrogation_Position=909; Antisense; AGACCTTCATGGTTTAAGATAGCTC
>probe:Drosophila_2:1633498_at:702:267; Interrogation_Position=916; Antisense; CATGGTTTAAGATAGCTCAAGCCGG
>probe:Drosophila_2:1633498_at:306:659; Interrogation_Position=923; Antisense; TAAGATAGCTCAAGCCGGAGCCAGT
>probe:Drosophila_2:1633498_at:61:319; Interrogation_Position=936; Antisense; GCCGGAGCCAGTTGCCCAAAATAGC
>probe:Drosophila_2:1633498_at:432:127; Interrogation_Position=941; Antisense; AGCCAGTTGCCCAAAATAGCTCAAT
>probe:Drosophila_2:1633498_at:498:469; Interrogation_Position=946; Antisense; GTTGCCCAAAATAGCTCAATCAGAT
>probe:Drosophila_2:1633498_at:388:27; Interrogation_Position=956; Antisense; ATAGCTCAATCAGATTATCCTCGAA
>probe:Drosophila_2:1633498_at:534:461; Interrogation_Position=968; Antisense; GATTATCCTCGAAAACATGCTGATC
>probe:Drosophila_2:1633498_at:7:43; Interrogation_Position=975; Antisense; CTCGAAAACATGCTGATCACTTTGC
>probe:Drosophila_2:1633498_at:104:189; Interrogation_Position=981; Antisense; AACATGCTGATCACTTTGCAAAAGC
>probe:Drosophila_2:1633498_at:463:453; Interrogation_Position=989; Antisense; GATCACTTTGCAAAAGCTTCCAGTA

Paste this into a BLAST search page for me
GCTTCCAGTATAAAATTCGATGTGATACTGACGCAAAAGCTCAAGACCTTTGACGCAAAAGCTCAAGACCTTCATAGACCTTCATGGTTTAAGATAGCTCCATGGTTTAAGATAGCTCAAGCCGGTAAGATAGCTCAAGCCGGAGCCAGTGCCGGAGCCAGTTGCCCAAAATAGCAGCCAGTTGCCCAAAATAGCTCAATGTTGCCCAAAATAGCTCAATCAGATATAGCTCAATCAGATTATCCTCGAAGATTATCCTCGAAAACATGCTGATCCTCGAAAACATGCTGATCACTTTGCAACATGCTGATCACTTTGCAAAAGCGATCACTTTGCAAAAGCTTCCAGTA

Full Affymetrix probeset data:

Annotations for 1633498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720