Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633499_at:

>probe:Drosophila_2:1633499_at:593:563; Interrogation_Position=298; Antisense; GGAAGAGCAACAGGTCTCCTCCGCA
>probe:Drosophila_2:1633499_at:129:449; Interrogation_Position=338; Antisense; GATCCGATTAGTGGCCGTCTTGTCT
>probe:Drosophila_2:1633499_at:114:449; Interrogation_Position=397; Antisense; GATCCTGGCCGCTCGTAATGGACTA
>probe:Drosophila_2:1633499_at:254:135; Interrogation_Position=421; Antisense; ACGAACCGTATTGACCATCCAGGAG
>probe:Drosophila_2:1633499_at:300:35; Interrogation_Position=501; Antisense; ATCAGACCCAGACGGTGGTGCACGA
>probe:Drosophila_2:1633499_at:728:591; Interrogation_Position=516; Antisense; TGGTGCACGATCACCGCCGATTGGT
>probe:Drosophila_2:1633499_at:650:293; Interrogation_Position=533; Antisense; CGATTGGTCACACCCATTGTGGCAC
>probe:Drosophila_2:1633499_at:433:113; Interrogation_Position=588; Antisense; AGCAGCCACCACTTCTGTGGAGCGT
>probe:Drosophila_2:1633499_at:549:83; Interrogation_Position=628; Antisense; AGTGGTTCTCATCCGCAACTAAGGA
>probe:Drosophila_2:1633499_at:545:383; Interrogation_Position=676; Antisense; GAACTCGCCAAAGCTATGATACTTC
>probe:Drosophila_2:1633499_at:388:603; Interrogation_Position=692; Antisense; TGATACTTCTATTCTTAACTCCCTT
>probe:Drosophila_2:1633499_at:257:109; Interrogation_Position=734; Antisense; ACAAAAAGCTTTCTCCTCTACGTCT
>probe:Drosophila_2:1633499_at:290:645; Interrogation_Position=759; Antisense; TCTTTCTTCTGCCATTTTCTGTAGA
>probe:Drosophila_2:1633499_at:711:95; Interrogation_Position=781; Antisense; AGATTTCTTCTGTAGCGTGCTTTCA

Paste this into a BLAST search page for me
GGAAGAGCAACAGGTCTCCTCCGCAGATCCGATTAGTGGCCGTCTTGTCTGATCCTGGCCGCTCGTAATGGACTAACGAACCGTATTGACCATCCAGGAGATCAGACCCAGACGGTGGTGCACGATGGTGCACGATCACCGCCGATTGGTCGATTGGTCACACCCATTGTGGCACAGCAGCCACCACTTCTGTGGAGCGTAGTGGTTCTCATCCGCAACTAAGGAGAACTCGCCAAAGCTATGATACTTCTGATACTTCTATTCTTAACTCCCTTACAAAAAGCTTTCTCCTCTACGTCTTCTTTCTTCTGCCATTTTCTGTAGAAGATTTCTTCTGTAGCGTGCTTTCA

Full Affymetrix probeset data:

Annotations for 1633499_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime