FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633502_at:

>probe:Drosophila_2:1633502_at:397:53; Interrogation_Position=13; Antisense; ATGCTTCAGTTGTGCACCATCTACG
>probe:Drosophila_2:1633502_at:658:329; Interrogation_Position=137; Antisense; GCGGAGTTCGTTTGGGCGACACCCT
>probe:Drosophila_2:1633502_at:295:595; Interrogation_Position=149; Antisense; TGGGCGACACCCTGCTGGAGCTGAA
>probe:Drosophila_2:1633502_at:481:587; Interrogation_Position=164; Antisense; TGGAGCTGAATGGAGCCGATGTCCT
>probe:Drosophila_2:1633502_at:441:729; Interrogation_Position=208; Antisense; TTGGCCAATCGGTTGCAGGATCACT
>probe:Drosophila_2:1633502_at:405:637; Interrogation_Position=251; Antisense; TCGTGACCCTGATGATGTGGCGCCA
>probe:Drosophila_2:1633502_at:461:575; Interrogation_Position=279; Antisense; GGCGAACATCGACCCCAATGAGGAT
>probe:Drosophila_2:1633502_at:23:251; Interrogation_Position=294; Antisense; CAATGAGGATCCTGCCGAGGCATCA
>probe:Drosophila_2:1633502_at:410:319; Interrogation_Position=307; Antisense; GCCGAGGCATCACATGCTGTGGTAA
>probe:Drosophila_2:1633502_at:319:519; Interrogation_Position=325; Antisense; GTGGTAAGTAGTCGCCACTTGTGCT
>probe:Drosophila_2:1633502_at:476:149; Interrogation_Position=341; Antisense; ACTTGTGCTCCATATTGTTGGCCTA
>probe:Drosophila_2:1633502_at:214:299; Interrogation_Position=42; Antisense; CGCGAACGGCACATTGGGACTGAAT
>probe:Drosophila_2:1633502_at:192:5; Interrogation_Position=54; Antisense; ATTGGGACTGAATTTGAGCCGTGCC
>probe:Drosophila_2:1633502_at:506:285; Interrogation_Position=81; Antisense; CTGGGATCCGTATCCTTGGGTTAGC

Paste this into a BLAST search page for me
ATGCTTCAGTTGTGCACCATCTACGGCGGAGTTCGTTTGGGCGACACCCTTGGGCGACACCCTGCTGGAGCTGAATGGAGCTGAATGGAGCCGATGTCCTTTGGCCAATCGGTTGCAGGATCACTTCGTGACCCTGATGATGTGGCGCCAGGCGAACATCGACCCCAATGAGGATCAATGAGGATCCTGCCGAGGCATCAGCCGAGGCATCACATGCTGTGGTAAGTGGTAAGTAGTCGCCACTTGTGCTACTTGTGCTCCATATTGTTGGCCTACGCGAACGGCACATTGGGACTGAATATTGGGACTGAATTTGAGCCGTGCCCTGGGATCCGTATCCTTGGGTTAGC

Full Affymetrix probeset data:

Annotations for 1633502_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720