FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633503_at:

>probe:Drosophila_2:1633503_at:487:285; Interrogation_Position=453; Antisense; CTGGTCACACCGGAGCTAATCAAGA
>probe:Drosophila_2:1633503_at:322:515; Interrogation_Position=498; Antisense; GTGTCTAGTGTGAACGGCATCCGTT
>probe:Drosophila_2:1633503_at:381:273; Interrogation_Position=524; Antisense; CTTTCCCGGAGTCTTAGCATACAAT
>probe:Drosophila_2:1633503_at:258:227; Interrogation_Position=555; Antisense; AAGGCTGCCGTGGATCAGTTCACCA
>probe:Drosophila_2:1633503_at:372:93; Interrogation_Position=571; Antisense; AGTTCACCAGGTGCGTGGCTCTGGA
>probe:Drosophila_2:1633503_at:30:117; Interrogation_Position=599; Antisense; AGCTCCCAAGGGTGTGCGTGTGAAC
>probe:Drosophila_2:1633503_at:494:613; Interrogation_Position=628; Antisense; TGAATCCCGGCGTAATCATCACCGA
>probe:Drosophila_2:1633503_at:245:37; Interrogation_Position=642; Antisense; ATCATCACCGAGCTGCAGCGTCGTG
>probe:Drosophila_2:1633503_at:729:405; Interrogation_Position=670; Antisense; GACTGGACCAGGAAGCCTACGTCAA
>probe:Drosophila_2:1633503_at:209:217; Interrogation_Position=693; Antisense; AAGTTCCTCGAGCACGCCAAGGTCA
>probe:Drosophila_2:1633503_at:668:627; Interrogation_Position=836; Antisense; TGCCATGTGCCCCAGATAAGAACGG
>probe:Drosophila_2:1633503_at:35:291; Interrogation_Position=858; Antisense; CGGAGTTTTTTATCCATGCATGCAT
>probe:Drosophila_2:1633503_at:223:663; Interrogation_Position=907; Antisense; TAAAGTAGCGCGCTTACCTCGTGTA
>probe:Drosophila_2:1633503_at:707:321; Interrogation_Position=916; Antisense; GCGCTTACCTCGTGTATTTCAAATA

Paste this into a BLAST search page for me
CTGGTCACACCGGAGCTAATCAAGAGTGTCTAGTGTGAACGGCATCCGTTCTTTCCCGGAGTCTTAGCATACAATAAGGCTGCCGTGGATCAGTTCACCAAGTTCACCAGGTGCGTGGCTCTGGAAGCTCCCAAGGGTGTGCGTGTGAACTGAATCCCGGCGTAATCATCACCGAATCATCACCGAGCTGCAGCGTCGTGGACTGGACCAGGAAGCCTACGTCAAAAGTTCCTCGAGCACGCCAAGGTCATGCCATGTGCCCCAGATAAGAACGGCGGAGTTTTTTATCCATGCATGCATTAAAGTAGCGCGCTTACCTCGTGTAGCGCTTACCTCGTGTATTTCAAATA

Full Affymetrix probeset data:

Annotations for 1633503_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720