Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633505_at:

>probe:Drosophila_2:1633505_at:352:683; Interrogation_Position=2460; Antisense; TATGCATCCACATCGGGCAGTGGCA
>probe:Drosophila_2:1633505_at:540:483; Interrogation_Position=2546; Antisense; GTATCCGGCCCAAGTGCAAGGCATG
>probe:Drosophila_2:1633505_at:675:359; Interrogation_Position=2561; Antisense; GCAAGGCATGCCTATTCCATATGGA
>probe:Drosophila_2:1633505_at:376:9; Interrogation_Position=2574; Antisense; ATTCCATATGGAGCCCAGCCAGGTG
>probe:Drosophila_2:1633505_at:361:293; Interrogation_Position=2626; Antisense; CGATGCCGCAGAGCTTCAATCCATA
>probe:Drosophila_2:1633505_at:514:305; Interrogation_Position=2656; Antisense; CCTTGCCGTATCCTGGTAACTATCA
>probe:Drosophila_2:1633505_at:371:191; Interrogation_Position=2673; Antisense; AACTATCAGTACCAGGGATTCCCGC
>probe:Drosophila_2:1633505_at:396:147; Interrogation_Position=2716; Antisense; ACTACGGAACATACCCAGGCAGTTA
>probe:Drosophila_2:1633505_at:379:115; Interrogation_Position=2749; Antisense; AGCAGGGTGGATATCCCAACCAGAA
>probe:Drosophila_2:1633505_at:474:261; Interrogation_Position=2776; Antisense; CACCTGGCTGGTAAATGGCGCTGTA
>probe:Drosophila_2:1633505_at:122:577; Interrogation_Position=2792; Antisense; GGCGCTGTAGCTGTAATCAAGTTCA
>probe:Drosophila_2:1633505_at:446:217; Interrogation_Position=2810; Antisense; AAGTTCATGTCCACATGTGCGCAGT
>probe:Drosophila_2:1633505_at:507:531; Interrogation_Position=2848; Antisense; GGGTCAATCGCATGGCAGAGCCTCA
>probe:Drosophila_2:1633505_at:639:17; Interrogation_Position=2916; Antisense; ATTTAATGCTCCGTGTTCTGGTTCT

Paste this into a BLAST search page for me
TATGCATCCACATCGGGCAGTGGCAGTATCCGGCCCAAGTGCAAGGCATGGCAAGGCATGCCTATTCCATATGGAATTCCATATGGAGCCCAGCCAGGTGCGATGCCGCAGAGCTTCAATCCATACCTTGCCGTATCCTGGTAACTATCAAACTATCAGTACCAGGGATTCCCGCACTACGGAACATACCCAGGCAGTTAAGCAGGGTGGATATCCCAACCAGAACACCTGGCTGGTAAATGGCGCTGTAGGCGCTGTAGCTGTAATCAAGTTCAAAGTTCATGTCCACATGTGCGCAGTGGGTCAATCGCATGGCAGAGCCTCAATTTAATGCTCCGTGTTCTGGTTCT

Full Affymetrix probeset data:

Annotations for 1633505_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime