FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633508_at:

>probe:Drosophila_2:1633508_at:730:559; Interrogation_Position=276; Antisense; TCCGCAAACGAACGTTGAAAGCGAT
>probe:Drosophila_2:1633508_at:60:297; Interrogation_Position=284; Antisense; CGAACGTTGAAAGCGATGAACGCGT
>probe:Drosophila_2:1633508_at:52:195; Interrogation_Position=514; Antisense; AATCGGTTAAGCTCGAAACGCGTGA
>probe:Drosophila_2:1633508_at:717:117; Interrogation_Position=523; Antisense; AGCTCGAAACGCGTGATATCCAAAA
>probe:Drosophila_2:1633508_at:449:329; Interrogation_Position=533; Antisense; GCGTGATATCCAAAAGGATGCCATT
>probe:Drosophila_2:1633508_at:254:547; Interrogation_Position=548; Antisense; GGATGCCATTAAGGACAACGGTTAC
>probe:Drosophila_2:1633508_at:725:539; Interrogation_Position=567; Antisense; GGTTACAATCGTTAGTGAAGCCATT
>probe:Drosophila_2:1633508_at:657:377; Interrogation_Position=583; Antisense; GAAGCCATTAGTTCGGAGGGCCAAT
>probe:Drosophila_2:1633508_at:641:271; Interrogation_Position=588; Antisense; CATTAGTTCGGAGGGCCAATATGCG
>probe:Drosophila_2:1633508_at:503:547; Interrogation_Position=597; Antisense; GGAGGGCCAATATGCGAAAATCACA
>probe:Drosophila_2:1633508_at:440:185; Interrogation_Position=613; Antisense; AAAATCACATTTACACACACGCTCG
>probe:Drosophila_2:1633508_at:276:273; Interrogation_Position=620; Antisense; CATTTACACACACGCTCGCTGTCAA
>probe:Drosophila_2:1633508_at:113:307; Interrogation_Position=647; Antisense; CCATCGACTTCACCCGGAAAAATGT
>probe:Drosophila_2:1633508_at:13:647; Interrogation_Position=656; Antisense; TCACCCGGAAAAATGTTGCAGAATA

Paste this into a BLAST search page for me
TCCGCAAACGAACGTTGAAAGCGATCGAACGTTGAAAGCGATGAACGCGTAATCGGTTAAGCTCGAAACGCGTGAAGCTCGAAACGCGTGATATCCAAAAGCGTGATATCCAAAAGGATGCCATTGGATGCCATTAAGGACAACGGTTACGGTTACAATCGTTAGTGAAGCCATTGAAGCCATTAGTTCGGAGGGCCAATCATTAGTTCGGAGGGCCAATATGCGGGAGGGCCAATATGCGAAAATCACAAAAATCACATTTACACACACGCTCGCATTTACACACACGCTCGCTGTCAACCATCGACTTCACCCGGAAAAATGTTCACCCGGAAAAATGTTGCAGAATA

Full Affymetrix probeset data:

Annotations for 1633508_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720