FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633509_at:

>probe:Drosophila_2:1633509_at:22:35; Interrogation_Position=1069; Antisense; ATCAGCGATTTGACAGGCCCGCAAA
>probe:Drosophila_2:1633509_at:728:357; Interrogation_Position=1089; Antisense; GCAAATCGCTGGTTTGTCTGTCAAA
>probe:Drosophila_2:1633509_at:451:247; Interrogation_Position=1112; Antisense; AATTGACATTACACGCAGCGACGCG
>probe:Drosophila_2:1633509_at:724:715; Interrogation_Position=1194; Antisense; TTCTGTTCCTGTGTATTTGTGTGCC
>probe:Drosophila_2:1633509_at:152:491; Interrogation_Position=1231; Antisense; GTACAGATTTTCTTAATGCGCCAAA
>probe:Drosophila_2:1633509_at:57:171; Interrogation_Position=1253; Antisense; AAAGTGCCACTTGTCGTCTGTTGAC
>probe:Drosophila_2:1633509_at:616:109; Interrogation_Position=1307; Antisense; AGAAGTTCCACAATCTGCACAGAAA
>probe:Drosophila_2:1633509_at:311:49; Interrogation_Position=1340; Antisense; ATGCCAGAGATCGAAGCCGTTTTGT
>probe:Drosophila_2:1633509_at:571:301; Interrogation_Position=1356; Antisense; CCGTTTTGTACGTGTCTTGGCAGTA
>probe:Drosophila_2:1633509_at:12:531; Interrogation_Position=1422; Antisense; GGGTAGCCTCAAAACTTGTCCGTCA
>probe:Drosophila_2:1633509_at:333:503; Interrogation_Position=1439; Antisense; GTCCGTCACCCAGGCAAAATTCTAA
>probe:Drosophila_2:1633509_at:224:333; Interrogation_Position=1466; Antisense; GCTGGCCAACGCACAATTTGTCACA
>probe:Drosophila_2:1633509_at:695:615; Interrogation_Position=1520; Antisense; TGCACCTTTGCCTTCGAACTGAAAA
>probe:Drosophila_2:1633509_at:140:575; Interrogation_Position=988; Antisense; GGCGGCAAGCTCATCGATCAGTTGA

Paste this into a BLAST search page for me
ATCAGCGATTTGACAGGCCCGCAAAGCAAATCGCTGGTTTGTCTGTCAAAAATTGACATTACACGCAGCGACGCGTTCTGTTCCTGTGTATTTGTGTGCCGTACAGATTTTCTTAATGCGCCAAAAAAGTGCCACTTGTCGTCTGTTGACAGAAGTTCCACAATCTGCACAGAAAATGCCAGAGATCGAAGCCGTTTTGTCCGTTTTGTACGTGTCTTGGCAGTAGGGTAGCCTCAAAACTTGTCCGTCAGTCCGTCACCCAGGCAAAATTCTAAGCTGGCCAACGCACAATTTGTCACATGCACCTTTGCCTTCGAACTGAAAAGGCGGCAAGCTCATCGATCAGTTGA

Full Affymetrix probeset data:

Annotations for 1633509_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720