FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633510_at:

>probe:Drosophila_2:1633510_at:698:405; Interrogation_Position=1019; Antisense; GACTGAACAGTCGATTCTGCTCGCG
>probe:Drosophila_2:1633510_at:108:643; Interrogation_Position=1034; Antisense; TCTGCTCGCGTCCTTATTGATTTTC
>probe:Drosophila_2:1633510_at:435:389; Interrogation_Position=1114; Antisense; GAAACACTAGCCAAATCGTCGGTAT
>probe:Drosophila_2:1633510_at:370:637; Interrogation_Position=1129; Antisense; TCGTCGGTATCATTGGCTAGATCCA
>probe:Drosophila_2:1633510_at:83:577; Interrogation_Position=1189; Antisense; GGCGCGATTCCACCAAGATGTCCAG
>probe:Drosophila_2:1633510_at:464:275; Interrogation_Position=1247; Antisense; CTTCGACGGGCGCACTGCTAATGTG
>probe:Drosophila_2:1633510_at:464:9; Interrogation_Position=1324; Antisense; ATTCGCATCGCAATGTGACGGGAGT
>probe:Drosophila_2:1633510_at:440:405; Interrogation_Position=1340; Antisense; GACGGGAGTAAGGTGCCATCTTCTG
>probe:Drosophila_2:1633510_at:35:495; Interrogation_Position=1371; Antisense; GTCAATCAGCATTTGCGGATCCTTC
>probe:Drosophila_2:1633510_at:514:685; Interrogation_Position=838; Antisense; TATTCCACAAGGTCAAGCAGTACGA
>probe:Drosophila_2:1633510_at:118:613; Interrogation_Position=880; Antisense; TGACAAATTTATTGGCGGCCGCGCG
>probe:Drosophila_2:1633510_at:725:171; Interrogation_Position=905; Antisense; AAAGTTCATTCACTTCTTTCGCTCC
>probe:Drosophila_2:1633510_at:548:305; Interrogation_Position=928; Antisense; CCGGCCAGTTGGGTCACATGAATCT
>probe:Drosophila_2:1633510_at:84:361; Interrogation_Position=947; Antisense; GAATCTGGACGAACCCAGTGGTTTC

Paste this into a BLAST search page for me
GACTGAACAGTCGATTCTGCTCGCGTCTGCTCGCGTCCTTATTGATTTTCGAAACACTAGCCAAATCGTCGGTATTCGTCGGTATCATTGGCTAGATCCAGGCGCGATTCCACCAAGATGTCCAGCTTCGACGGGCGCACTGCTAATGTGATTCGCATCGCAATGTGACGGGAGTGACGGGAGTAAGGTGCCATCTTCTGGTCAATCAGCATTTGCGGATCCTTCTATTCCACAAGGTCAAGCAGTACGATGACAAATTTATTGGCGGCCGCGCGAAAGTTCATTCACTTCTTTCGCTCCCCGGCCAGTTGGGTCACATGAATCTGAATCTGGACGAACCCAGTGGTTTC

Full Affymetrix probeset data:

Annotations for 1633510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720