FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633512_at:

>probe:Drosophila_2:1633512_at:278:543; Interrogation_Position=1767; Antisense; GGATTCAACACCATGTACTCATCTA
>probe:Drosophila_2:1633512_at:656:667; Interrogation_Position=1782; Antisense; TACTCATCTATTCCACAACCGATTG
>probe:Drosophila_2:1633512_at:284:53; Interrogation_Position=1856; Antisense; ATGCTTACAACAACGCGATGCCTAT
>probe:Drosophila_2:1633512_at:568:49; Interrogation_Position=1873; Antisense; ATGCCTATCCTTACATGTTTCACGA
>probe:Drosophila_2:1633512_at:214:477; Interrogation_Position=1889; Antisense; GTTTCACGATCCGTTATCACTAGGA
>probe:Drosophila_2:1633512_at:645:27; Interrogation_Position=1996; Antisense; ATACCAATAGTTCTCCAATGCCATC
>probe:Drosophila_2:1633512_at:118:187; Interrogation_Position=2025; Antisense; AACACAGGTGTCATTTCTGCGGGCG
>probe:Drosophila_2:1633512_at:244:507; Interrogation_Position=2055; Antisense; GTGCCTGTCCAGATTTCAACGCAAA
>probe:Drosophila_2:1633512_at:383:287; Interrogation_Position=2095; Antisense; CGGGAAGCAATTACTGGCCACGTCT
>probe:Drosophila_2:1633512_at:631:579; Interrogation_Position=2110; Antisense; GGCCACGTCTTCAGTGATCGTCAAT
>probe:Drosophila_2:1633512_at:31:607; Interrogation_Position=2124; Antisense; TGATCGTCAATCTTTGGCTCACCAT
>probe:Drosophila_2:1633512_at:410:571; Interrogation_Position=2139; Antisense; GGCTCACCATTAGATCATTTGTCAA
>probe:Drosophila_2:1633512_at:199:239; Interrogation_Position=2180; Antisense; AATCATTGCCGCACAAGCAGCTGAG
>probe:Drosophila_2:1633512_at:99:399; Interrogation_Position=2287; Antisense; GACAGACAACGTGCTGTTCATCCAG

Paste this into a BLAST search page for me
GGATTCAACACCATGTACTCATCTATACTCATCTATTCCACAACCGATTGATGCTTACAACAACGCGATGCCTATATGCCTATCCTTACATGTTTCACGAGTTTCACGATCCGTTATCACTAGGAATACCAATAGTTCTCCAATGCCATCAACACAGGTGTCATTTCTGCGGGCGGTGCCTGTCCAGATTTCAACGCAAACGGGAAGCAATTACTGGCCACGTCTGGCCACGTCTTCAGTGATCGTCAATTGATCGTCAATCTTTGGCTCACCATGGCTCACCATTAGATCATTTGTCAAAATCATTGCCGCACAAGCAGCTGAGGACAGACAACGTGCTGTTCATCCAG

Full Affymetrix probeset data:

Annotations for 1633512_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720