FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633514_at:

>probe:Drosophila_2:1633514_at:55:301; Interrogation_Position=1084; Antisense; CGCCATCCTGCAGACATTTATCAAG
>probe:Drosophila_2:1633514_at:181:705; Interrogation_Position=1101; Antisense; TTATCAAGACATTGACCGCCGCATG
>probe:Drosophila_2:1633514_at:594:51; Interrogation_Position=1123; Antisense; ATGCAGAGCCGACCGGAGACCGTTT
>probe:Drosophila_2:1633514_at:672:103; Interrogation_Position=1139; Antisense; AGACCGTTTGTCTTGCACTTGACCA
>probe:Drosophila_2:1633514_at:468:331; Interrogation_Position=1220; Antisense; GCGGCCCTTTGAACATGAACACCAG
>probe:Drosophila_2:1633514_at:723:47; Interrogation_Position=1275; Antisense; ATCCACTGGCCTACACAAATTTGAG
>probe:Drosophila_2:1633514_at:606:163; Interrogation_Position=1291; Antisense; AAATTTGAGGCTTTGCAATCGCAAA
>probe:Drosophila_2:1633514_at:87:659; Interrogation_Position=1363; Antisense; TAAGTCACCAGAAACCATGCCACAA
>probe:Drosophila_2:1633514_at:241:237; Interrogation_Position=853; Antisense; AATCTAGCCCATGGTAACTCGAATT
>probe:Drosophila_2:1633514_at:178:195; Interrogation_Position=910; Antisense; AACTCCATTTGCGTGGTCATGTGGC
>probe:Drosophila_2:1633514_at:592:495; Interrogation_Position=925; Antisense; GTCATGTGGCATCGTAGCTGGCTCA
>probe:Drosophila_2:1633514_at:112:293; Interrogation_Position=937; Antisense; CGTAGCTGGCTCATTACAGTCATGA
>probe:Drosophila_2:1633514_at:377:421; Interrogation_Position=960; Antisense; GAGCACATAATACACAGCCCGGACA
>probe:Drosophila_2:1633514_at:703:111; Interrogation_Position=975; Antisense; AGCCCGGACACGTGACGGTGATTTA

Paste this into a BLAST search page for me
CGCCATCCTGCAGACATTTATCAAGTTATCAAGACATTGACCGCCGCATGATGCAGAGCCGACCGGAGACCGTTTAGACCGTTTGTCTTGCACTTGACCAGCGGCCCTTTGAACATGAACACCAGATCCACTGGCCTACACAAATTTGAGAAATTTGAGGCTTTGCAATCGCAAATAAGTCACCAGAAACCATGCCACAAAATCTAGCCCATGGTAACTCGAATTAACTCCATTTGCGTGGTCATGTGGCGTCATGTGGCATCGTAGCTGGCTCACGTAGCTGGCTCATTACAGTCATGAGAGCACATAATACACAGCCCGGACAAGCCCGGACACGTGACGGTGATTTA

Full Affymetrix probeset data:

Annotations for 1633514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720