FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633516_at:

>probe:Drosophila_2:1633516_at:374:85; Interrogation_Position=114; Antisense; AGTGAGAACTTCCAGCAGCCTATTG
>probe:Drosophila_2:1633516_at:379:113; Interrogation_Position=127; Antisense; AGCAGCCTATTGTGATTACTCCCAA
>probe:Drosophila_2:1633516_at:625:651; Interrogation_Position=14; Antisense; TAATAGTTCGATGGACCCCTCAAAC
>probe:Drosophila_2:1633516_at:690:597; Interrogation_Position=157; Antisense; TGTGCGCCCAGGGAATGCCCATGAA
>probe:Drosophila_2:1633516_at:207:51; Interrogation_Position=171; Antisense; ATGCCCATGAATGACGTGTGCCGAG
>probe:Drosophila_2:1633516_at:335:677; Interrogation_Position=200; Antisense; TAGTGGCGGCCCCTTTATGGACGAC
>probe:Drosophila_2:1633516_at:655:609; Interrogation_Position=214; Antisense; TTATGGACGACGGTACCTCCGGCGT
>probe:Drosophila_2:1633516_at:226:131; Interrogation_Position=228; Antisense; ACCTCCGGCGTCTTTGGAACAAGTG
>probe:Drosophila_2:1633516_at:244:519; Interrogation_Position=250; Antisense; GTGGACGTTATACGATCATCGGCAT
>probe:Drosophila_2:1633516_at:385:23; Interrogation_Position=273; Antisense; ATCGTGGCCTTTGGACCGACGCTGT
>probe:Drosophila_2:1633516_at:483:515; Interrogation_Position=319; Antisense; GGGTCTACACCCTGGTGAGTAGCTT
>probe:Drosophila_2:1633516_at:251:117; Interrogation_Position=339; Antisense; AGCTTCTCCGATTGGATACTGCGAA
>probe:Drosophila_2:1633516_at:316:209; Interrogation_Position=362; Antisense; AAGCATCGCCGAAGGATCTGACCAG
>probe:Drosophila_2:1633516_at:116:635; Interrogation_Position=97; Antisense; TCGCCTATGCCAGTCTCAGTGAGAA

Paste this into a BLAST search page for me
AGTGAGAACTTCCAGCAGCCTATTGAGCAGCCTATTGTGATTACTCCCAATAATAGTTCGATGGACCCCTCAAACTGTGCGCCCAGGGAATGCCCATGAAATGCCCATGAATGACGTGTGCCGAGTAGTGGCGGCCCCTTTATGGACGACTTATGGACGACGGTACCTCCGGCGTACCTCCGGCGTCTTTGGAACAAGTGGTGGACGTTATACGATCATCGGCATATCGTGGCCTTTGGACCGACGCTGTGGGTCTACACCCTGGTGAGTAGCTTAGCTTCTCCGATTGGATACTGCGAAAAGCATCGCCGAAGGATCTGACCAGTCGCCTATGCCAGTCTCAGTGAGAA

Full Affymetrix probeset data:

Annotations for 1633516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720