FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633517_at:

>probe:Drosophila_2:1633517_at:661:53; Interrogation_Position=2881; Antisense; ATGCATGCATTACACATTGGAGCCA
>probe:Drosophila_2:1633517_at:47:275; Interrogation_Position=2895; Antisense; CATTGGAGCCACTAAATTTGTAAAT
>probe:Drosophila_2:1633517_at:57:25; Interrogation_Position=2933; Antisense; ATATGAATGTCTTGTGTAGTCCCAC
>probe:Drosophila_2:1633517_at:378:271; Interrogation_Position=2970; Antisense; CATAAACACTCCCACACAAAATACA
>probe:Drosophila_2:1633517_at:162:241; Interrogation_Position=2989; Antisense; AATACAGTCACACACACTCATTTTT
>probe:Drosophila_2:1633517_at:176:491; Interrogation_Position=3093; Antisense; GTAAAACGCCTGTTGGTGAAATGTT
>probe:Drosophila_2:1633517_at:266:687; Interrogation_Position=3187; Antisense; TATAGTGCAGGTTCAGCCGATTTAT
>probe:Drosophila_2:1633517_at:720:209; Interrogation_Position=3243; Antisense; AAGCAAATTTTGTGAGGCCCTCTGT
>probe:Drosophila_2:1633517_at:615:511; Interrogation_Position=3254; Antisense; GTGAGGCCCTCTGTTGGAACAACAA
>probe:Drosophila_2:1633517_at:173:175; Interrogation_Position=3277; Antisense; AAAGCCAAGCCGGAGTGCAGAGAAA
>probe:Drosophila_2:1633517_at:522:79; Interrogation_Position=3360; Antisense; AGGTATAATCAATATGTTCGCAACA
>probe:Drosophila_2:1633517_at:284:719; Interrogation_Position=3376; Antisense; TTCGCAACATGCGTAGGTTCAAAAC
>probe:Drosophila_2:1633517_at:252:541; Interrogation_Position=3391; Antisense; GGTTCAAAACACTAATCAGCATATA
>probe:Drosophila_2:1633517_at:140:145; Interrogation_Position=3416; Antisense; AATAGCGTCTAACACATTTTTAATA

Paste this into a BLAST search page for me
ATGCATGCATTACACATTGGAGCCACATTGGAGCCACTAAATTTGTAAATATATGAATGTCTTGTGTAGTCCCACCATAAACACTCCCACACAAAATACAAATACAGTCACACACACTCATTTTTGTAAAACGCCTGTTGGTGAAATGTTTATAGTGCAGGTTCAGCCGATTTATAAGCAAATTTTGTGAGGCCCTCTGTGTGAGGCCCTCTGTTGGAACAACAAAAAGCCAAGCCGGAGTGCAGAGAAAAGGTATAATCAATATGTTCGCAACATTCGCAACATGCGTAGGTTCAAAACGGTTCAAAACACTAATCAGCATATAAATAGCGTCTAACACATTTTTAATA

Full Affymetrix probeset data:

Annotations for 1633517_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720