FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633520_at:

>probe:Drosophila_2:1633520_at:702:127; Interrogation_Position=515; Antisense; ACCATGCTGAAGTGCGCTGTTTCGA
>probe:Drosophila_2:1633520_at:665:567; Interrogation_Position=543; Antisense; GGCAGCCGATTTGATGACTAAGATT
>probe:Drosophila_2:1633520_at:533:461; Interrogation_Position=564; Antisense; GATTCATCCCAATTAAACGACCTAT
>probe:Drosophila_2:1633520_at:393:11; Interrogation_Position=587; Antisense; ATTAAACTCAACTGTGGTGCACGGA
>probe:Drosophila_2:1633520_at:118:389; Interrogation_Position=653; Antisense; GAAAACGGGAACTGCTGTGCCATTT
>probe:Drosophila_2:1633520_at:692:283; Interrogation_Position=664; Antisense; CTGCTGTGCCATTTAGACCAAACTG
>probe:Drosophila_2:1633520_at:510:413; Interrogation_Position=679; Antisense; GACCAAACTGGCAACCTGTTACATA
>probe:Drosophila_2:1633520_at:582:151; Interrogation_Position=699; Antisense; ACATATTTCAGCCACGTTAGCCAGG
>probe:Drosophila_2:1633520_at:448:473; Interrogation_Position=714; Antisense; GTTAGCCAGGCGACACCTGAAGGTA
>probe:Drosophila_2:1633520_at:259:1; Interrogation_Position=734; Antisense; AGGTAATAACGGCAGGCCACCTGTT
>probe:Drosophila_2:1633520_at:688:579; Interrogation_Position=748; Antisense; GGCCACCTGTTGCTGATCACAAAGA
>probe:Drosophila_2:1633520_at:17:91; Interrogation_Position=799; Antisense; AGTACCCAATACTATGCCCTTATTT
>probe:Drosophila_2:1633520_at:98:219; Interrogation_Position=884; Antisense; AAGTCCATGTTTTTGTTGATCTATT
>probe:Drosophila_2:1633520_at:712:75; Interrogation_Position=992; Antisense; AGGATCGTACCTTATGTTCAGACAT

Paste this into a BLAST search page for me
ACCATGCTGAAGTGCGCTGTTTCGAGGCAGCCGATTTGATGACTAAGATTGATTCATCCCAATTAAACGACCTATATTAAACTCAACTGTGGTGCACGGAGAAAACGGGAACTGCTGTGCCATTTCTGCTGTGCCATTTAGACCAAACTGGACCAAACTGGCAACCTGTTACATAACATATTTCAGCCACGTTAGCCAGGGTTAGCCAGGCGACACCTGAAGGTAAGGTAATAACGGCAGGCCACCTGTTGGCCACCTGTTGCTGATCACAAAGAAGTACCCAATACTATGCCCTTATTTAAGTCCATGTTTTTGTTGATCTATTAGGATCGTACCTTATGTTCAGACAT

Full Affymetrix probeset data:

Annotations for 1633520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720