FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633522_at:

>probe:Drosophila_2:1633522_at:416:423; Interrogation_Position=3232; Antisense; GAGAACGAGTCCAGCTACTCCCTGG
>probe:Drosophila_2:1633522_at:559:669; Interrogation_Position=3247; Antisense; TACTCCCTGGGCGTTTATGAGCACT
>probe:Drosophila_2:1633522_at:147:683; Interrogation_Position=3262; Antisense; TATGAGCACTGCAAGATCTCCAAGT
>probe:Drosophila_2:1633522_at:184:439; Interrogation_Position=3297; Antisense; GAGGAATCGACACTATCAGCTGAAT
>probe:Drosophila_2:1633522_at:495:613; Interrogation_Position=3317; Antisense; TGAATCCGGAGACAGCCTACCTGCT
>probe:Drosophila_2:1633522_at:262:61; Interrogation_Position=3478; Antisense; ATGTCGGACTATGGCCAGCGCAGGC
>probe:Drosophila_2:1633522_at:600:189; Interrogation_Position=3505; Antisense; AACATGGCTGCCCTGAAGGTCCAAC
>probe:Drosophila_2:1633522_at:704:371; Interrogation_Position=3564; Antisense; GAAGGAGCCAAACCAGGCACCGAAT
>probe:Drosophila_2:1633522_at:704:197; Interrogation_Position=3607; Antisense; AACGATTCCCTGGAGCACTCGAACA
>probe:Drosophila_2:1633522_at:540:147; Interrogation_Position=3689; Antisense; ACTACCATGTGTTCCGCGAGGGCGA
>probe:Drosophila_2:1633522_at:327:83; Interrogation_Position=3707; Antisense; AGGGCGAGCTGGACGCACTGATCAA
>probe:Drosophila_2:1633522_at:329:63; Interrogation_Position=3737; Antisense; ATGTGGCCAGCCTGCACATCGTTAG
>probe:Drosophila_2:1633522_at:578:39; Interrogation_Position=3754; Antisense; ATCGTTAGCTCCTACTACGAGCGGG
>probe:Drosophila_2:1633522_at:250:371; Interrogation_Position=3801; Antisense; GAAGGTTCAGGTGTGGACCATCTAA

Paste this into a BLAST search page for me
GAGAACGAGTCCAGCTACTCCCTGGTACTCCCTGGGCGTTTATGAGCACTTATGAGCACTGCAAGATCTCCAAGTGAGGAATCGACACTATCAGCTGAATTGAATCCGGAGACAGCCTACCTGCTATGTCGGACTATGGCCAGCGCAGGCAACATGGCTGCCCTGAAGGTCCAACGAAGGAGCCAAACCAGGCACCGAATAACGATTCCCTGGAGCACTCGAACAACTACCATGTGTTCCGCGAGGGCGAAGGGCGAGCTGGACGCACTGATCAAATGTGGCCAGCCTGCACATCGTTAGATCGTTAGCTCCTACTACGAGCGGGGAAGGTTCAGGTGTGGACCATCTAA

Full Affymetrix probeset data:

Annotations for 1633522_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720