FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633523_at:

>probe:Drosophila_2:1633523_at:280:133; Interrogation_Position=1015; Antisense; ACCCTTTCTGCTGGACATTATCGGA
>probe:Drosophila_2:1633523_at:283:493; Interrogation_Position=1048; Antisense; GTAATGGTCTACGTTCCATGTCCGA
>probe:Drosophila_2:1633523_at:65:505; Interrogation_Position=1067; Antisense; GTCCGATGTCTTGATACCATGTTCA
>probe:Drosophila_2:1633523_at:425:141; Interrogation_Position=1196; Antisense; ACGGAGCTCTCCATATTTTATACTT
>probe:Drosophila_2:1633523_at:36:529; Interrogation_Position=1246; Antisense; GGGACCAGCATATTCATTTTACCGA
>probe:Drosophila_2:1633523_at:711:109; Interrogation_Position=1356; Antisense; AGAAGTCCACTCTAGTCTCGAATCA
>probe:Drosophila_2:1633523_at:5:565; Interrogation_Position=815; Antisense; GGAATGCCCTATCTGGATATCCTAC
>probe:Drosophila_2:1633523_at:26:169; Interrogation_Position=847; Antisense; AAAGGATTCCTATCCGTATCACACG
>probe:Drosophila_2:1633523_at:136:155; Interrogation_Position=867; Antisense; ACACGCTGTACGTCTACCAGGTTTC
>probe:Drosophila_2:1633523_at:124:429; Interrogation_Position=896; Antisense; GAGTTCGCTATGCTGTATCATGCCG
>probe:Drosophila_2:1633523_at:455:225; Interrogation_Position=923; Antisense; AAGGCGGGAGCCTTTGACCTCAAGG
>probe:Drosophila_2:1633523_at:729:279; Interrogation_Position=941; Antisense; CTCAAGGATGCCGTGCTGGAGGCCA
>probe:Drosophila_2:1633523_at:666:313; Interrogation_Position=962; Antisense; GCCATGAAGGGCTTTCGACGAGCTG
>probe:Drosophila_2:1633523_at:42:419; Interrogation_Position=981; Antisense; GAGCTGGTGCCGATTGCATCATCAC

Paste this into a BLAST search page for me
ACCCTTTCTGCTGGACATTATCGGAGTAATGGTCTACGTTCCATGTCCGAGTCCGATGTCTTGATACCATGTTCAACGGAGCTCTCCATATTTTATACTTGGGACCAGCATATTCATTTTACCGAAGAAGTCCACTCTAGTCTCGAATCAGGAATGCCCTATCTGGATATCCTACAAAGGATTCCTATCCGTATCACACGACACGCTGTACGTCTACCAGGTTTCGAGTTCGCTATGCTGTATCATGCCGAAGGCGGGAGCCTTTGACCTCAAGGCTCAAGGATGCCGTGCTGGAGGCCAGCCATGAAGGGCTTTCGACGAGCTGGAGCTGGTGCCGATTGCATCATCAC

Full Affymetrix probeset data:

Annotations for 1633523_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720