FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633526_at:

>probe:Drosophila_2:1633526_at:390:417; Interrogation_Position=3081; Antisense; GAGCGCAGCCCATTCAGAGTGGTTA
>probe:Drosophila_2:1633526_at:569:99; Interrogation_Position=3096; Antisense; AGAGTGGTTACCTGCACTACGGCAA
>probe:Drosophila_2:1633526_at:332:147; Interrogation_Position=3111; Antisense; ACTACGGCAACTATGGCGGATACGA
>probe:Drosophila_2:1633526_at:333:99; Interrogation_Position=3147; Antisense; AGAGTCAGCCACAGAACCAAGCGCC
>probe:Drosophila_2:1633526_at:314:201; Interrogation_Position=3227; Antisense; AACCAGACGGTGACCTCCAATTCGG
>probe:Drosophila_2:1633526_at:120:611; Interrogation_Position=3237; Antisense; TGACCTCCAATTCGGCAGCAATTAG
>probe:Drosophila_2:1633526_at:20:265; Interrogation_Position=3252; Antisense; CAGCAATTAGCATGCAGCAGCACCA
>probe:Drosophila_2:1633526_at:339:431; Interrogation_Position=3342; Antisense; GAGTCGGTGAGATGCTCTTCGAGCA
>probe:Drosophila_2:1633526_at:659:461; Interrogation_Position=3388; Antisense; GATTAGCAACATTCTGGCAGGAGTG
>probe:Drosophila_2:1633526_at:610:75; Interrogation_Position=3406; Antisense; AGGAGTGCGCAAGACCTGCTACAGC
>probe:Drosophila_2:1633526_at:401:413; Interrogation_Position=3418; Antisense; GACCTGCTACAGCAATTGACTCTGA
>probe:Drosophila_2:1633526_at:230:405; Interrogation_Position=3435; Antisense; GACTCTGATCAGACGACATTTGTAA
>probe:Drosophila_2:1633526_at:30:487; Interrogation_Position=3494; Antisense; GTAGTCTTAAGATTGCTTTCCGCAC
>probe:Drosophila_2:1633526_at:506:483; Interrogation_Position=3556; Antisense; GTAGTAGAACCACCCATTGAATTGT

Paste this into a BLAST search page for me
GAGCGCAGCCCATTCAGAGTGGTTAAGAGTGGTTACCTGCACTACGGCAAACTACGGCAACTATGGCGGATACGAAGAGTCAGCCACAGAACCAAGCGCCAACCAGACGGTGACCTCCAATTCGGTGACCTCCAATTCGGCAGCAATTAGCAGCAATTAGCATGCAGCAGCACCAGAGTCGGTGAGATGCTCTTCGAGCAGATTAGCAACATTCTGGCAGGAGTGAGGAGTGCGCAAGACCTGCTACAGCGACCTGCTACAGCAATTGACTCTGAGACTCTGATCAGACGACATTTGTAAGTAGTCTTAAGATTGCTTTCCGCACGTAGTAGAACCACCCATTGAATTGT

Full Affymetrix probeset data:

Annotations for 1633526_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720