Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633530_at:

>probe:Drosophila_2:1633530_at:27:365; Interrogation_Position=2471; Antisense; GAATAAATTTCAGTGCGCCAGCGCC
>probe:Drosophila_2:1633530_at:533:313; Interrogation_Position=2487; Antisense; GCCAGCGCCAGCTAACTAGCTAGAA
>probe:Drosophila_2:1633530_at:137:277; Interrogation_Position=2506; Antisense; CTAGAAAGCCCAGCAAAAGCAGCCA
>probe:Drosophila_2:1633530_at:600:261; Interrogation_Position=2537; Antisense; CAGCAGCAGCTAGAAACAATTTCAT
>probe:Drosophila_2:1633530_at:407:701; Interrogation_Position=2590; Antisense; TTTTGCCACTTTACCGTCTTCTGAA
>probe:Drosophila_2:1633530_at:299:613; Interrogation_Position=2611; Antisense; TGAAGACTTAATTTCTCCCCTCCAA
>probe:Drosophila_2:1633530_at:658:667; Interrogation_Position=2642; Antisense; TACTTATTTCCCCACTTTGTTCAAT
>probe:Drosophila_2:1633530_at:431:661; Interrogation_Position=2708; Antisense; TAACATGAAGCTTAATTGGCGCCAC
>probe:Drosophila_2:1633530_at:294:249; Interrogation_Position=2721; Antisense; AATTGGCGCCACTATTTAATAAGCA
>probe:Drosophila_2:1633530_at:451:383; Interrogation_Position=2750; Antisense; GAACGGAGTTGAGGCACTGGCACAA
>probe:Drosophila_2:1633530_at:283:491; Interrogation_Position=2832; Antisense; GTAATTTCGTGCATTAAAACCGACT
>probe:Drosophila_2:1633530_at:96:711; Interrogation_Position=2897; Antisense; TTAACTATGCTAACTGAGATTGCGC
>probe:Drosophila_2:1633530_at:39:429; Interrogation_Position=2912; Antisense; GAGATTGCGCAACAATATTCACAAT
>probe:Drosophila_2:1633530_at:551:177; Interrogation_Position=2955; Antisense; AAACATGATGATTAACTATTGCGGT

Paste this into a BLAST search page for me
GAATAAATTTCAGTGCGCCAGCGCCGCCAGCGCCAGCTAACTAGCTAGAACTAGAAAGCCCAGCAAAAGCAGCCACAGCAGCAGCTAGAAACAATTTCATTTTTGCCACTTTACCGTCTTCTGAATGAAGACTTAATTTCTCCCCTCCAATACTTATTTCCCCACTTTGTTCAATTAACATGAAGCTTAATTGGCGCCACAATTGGCGCCACTATTTAATAAGCAGAACGGAGTTGAGGCACTGGCACAAGTAATTTCGTGCATTAAAACCGACTTTAACTATGCTAACTGAGATTGCGCGAGATTGCGCAACAATATTCACAATAAACATGATGATTAACTATTGCGGT

Full Affymetrix probeset data:

Annotations for 1633530_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime