FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633531_at:

>probe:Drosophila_2:1633531_at:574:575; Interrogation_Position=1144; Antisense; GGCGTTGTCCGCATGCTGATAATAT
>probe:Drosophila_2:1633531_at:108:33; Interrogation_Position=1162; Antisense; ATAATATTCGTGCTGACATTCGCCC
>probe:Drosophila_2:1633531_at:117:237; Interrogation_Position=1192; Antisense; AATCTGCCGTATCATGCCCGCAAAA
>probe:Drosophila_2:1633531_at:667:583; Interrogation_Position=1219; Antisense; TGGCAGTACTGGTCACGTTCGTATC
>probe:Drosophila_2:1633531_at:422:471; Interrogation_Position=1235; Antisense; GTTCGTATCGCGGTGATTCCAATTT
>probe:Drosophila_2:1633531_at:686:697; Interrogation_Position=1258; Antisense; TTTAATGCGCTGCTAACACCGCTCA
>probe:Drosophila_2:1633531_at:491:487; Interrogation_Position=1291; Antisense; GTCACGTACTTCAATTCGGGCGTAA
>probe:Drosophila_2:1633531_at:319:647; Interrogation_Position=1337; Antisense; TCAGTCGCAATTTTCGGAAGGGCAT
>probe:Drosophila_2:1633531_at:148:221; Interrogation_Position=1390; Antisense; AAGGGCAAGGGCAAGTCCTCCTCGA
>probe:Drosophila_2:1633531_at:444:79; Interrogation_Position=1448; Antisense; AGGTGAGTACAATTGCCGACTTCCC
>probe:Drosophila_2:1633531_at:351:359; Interrogation_Position=1474; Antisense; GCAACCGGCATTTGGCACCTGATAT
>probe:Drosophila_2:1633531_at:219:587; Interrogation_Position=913; Antisense; TGGAGCGAAGTGACCACCGGCACAG
>probe:Drosophila_2:1633531_at:339:85; Interrogation_Position=950; Antisense; AGTGCGAGGCCAAAGTGTCCCTGGA
>probe:Drosophila_2:1633531_at:503:5; Interrogation_Position=988; Antisense; ATTGTCAGTGCCTGCCGCAAGACGA

Paste this into a BLAST search page for me
GGCGTTGTCCGCATGCTGATAATATATAATATTCGTGCTGACATTCGCCCAATCTGCCGTATCATGCCCGCAAAATGGCAGTACTGGTCACGTTCGTATCGTTCGTATCGCGGTGATTCCAATTTTTTAATGCGCTGCTAACACCGCTCAGTCACGTACTTCAATTCGGGCGTAATCAGTCGCAATTTTCGGAAGGGCATAAGGGCAAGGGCAAGTCCTCCTCGAAGGTGAGTACAATTGCCGACTTCCCGCAACCGGCATTTGGCACCTGATATTGGAGCGAAGTGACCACCGGCACAGAGTGCGAGGCCAAAGTGTCCCTGGAATTGTCAGTGCCTGCCGCAAGACGA

Full Affymetrix probeset data:

Annotations for 1633531_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720