FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633532_at:

>probe:Drosophila_2:1633532_at:312:683; Interrogation_Position=198; Antisense; TATCTGCCCATGCTGAACGAAGTGG
>probe:Drosophila_2:1633532_at:298:425; Interrogation_Position=273; Antisense; GAGACCGCCAATCTGACCGCCGAGG
>probe:Drosophila_2:1633532_at:667:373; Interrogation_Position=311; Antisense; GAAGATCTACCAGGCGGAGGTCACC
>probe:Drosophila_2:1633532_at:424:327; Interrogation_Position=324; Antisense; GCGGAGGTCACCAGCCTATGCAGCG
>probe:Drosophila_2:1633532_at:642:253; Interrogation_Position=371; Antisense; CAACGATACCACCAACTTCTTCAAG
>probe:Drosophila_2:1633532_at:570:713; Interrogation_Position=387; Antisense; TTCTTCAAGTGCTACGCCAATGCGG
>probe:Drosophila_2:1633532_at:375:311; Interrogation_Position=402; Antisense; GCCAATGCGGCCGAGAGTGATGTAT
>probe:Drosophila_2:1633532_at:571:483; Interrogation_Position=423; Antisense; GTATCTGTGATCTATGGCATCGCCA
>probe:Drosophila_2:1633532_at:150:609; Interrogation_Position=475; Antisense; TGAGCACAGGCATCCAGGCCATCCA
>probe:Drosophila_2:1633532_at:565:85; Interrogation_Position=514; Antisense; AGTGCACCAACACCACGGAGAGCAA
>probe:Drosophila_2:1633532_at:476:671; Interrogation_Position=564; Antisense; TACGATCTGTTGGACAGCTGCCTGA
>probe:Drosophila_2:1633532_at:713:117; Interrogation_Position=579; Antisense; AGCTGCCTGAAGTACGGAGTGCCCA
>probe:Drosophila_2:1633532_at:369:495; Interrogation_Position=663; Antisense; GTCACTGATGGCACCACTGTTGTGG
>probe:Drosophila_2:1633532_at:514:335; Interrogation_Position=702; Antisense; GCTGCTGACACCACTGTGGCTGTGA

Paste this into a BLAST search page for me
TATCTGCCCATGCTGAACGAAGTGGGAGACCGCCAATCTGACCGCCGAGGGAAGATCTACCAGGCGGAGGTCACCGCGGAGGTCACCAGCCTATGCAGCGCAACGATACCACCAACTTCTTCAAGTTCTTCAAGTGCTACGCCAATGCGGGCCAATGCGGCCGAGAGTGATGTATGTATCTGTGATCTATGGCATCGCCATGAGCACAGGCATCCAGGCCATCCAAGTGCACCAACACCACGGAGAGCAATACGATCTGTTGGACAGCTGCCTGAAGCTGCCTGAAGTACGGAGTGCCCAGTCACTGATGGCACCACTGTTGTGGGCTGCTGACACCACTGTGGCTGTGA

Full Affymetrix probeset data:

Annotations for 1633532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720