FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633533_at:

>probe:Drosophila_2:1633533_at:635:325; Interrogation_Position=2229; Antisense; GCGAGAGCATATGTAGATAAACCTA
>probe:Drosophila_2:1633533_at:79:661; Interrogation_Position=2277; Antisense; TAACAAACACTAGCCGTTGGTATCG
>probe:Drosophila_2:1633533_at:491:675; Interrogation_Position=2287; Antisense; TAGCCGTTGGTATCGTAATAGTGAA
>probe:Drosophila_2:1633533_at:91:239; Interrogation_Position=2358; Antisense; CAATACCCCATTAACTAGTCACAGT
>probe:Drosophila_2:1633533_at:318:677; Interrogation_Position=2373; Antisense; TAGTCACAGTACTTAAGGTTCCACA
>probe:Drosophila_2:1633533_at:230:469; Interrogation_Position=2390; Antisense; GTTCCACAACTAAACCGATTACGAT
>probe:Drosophila_2:1633533_at:106:19; Interrogation_Position=2420; Antisense; ATTTCGATTTTGTTCTTCATCCGCA
>probe:Drosophila_2:1633533_at:54:277; Interrogation_Position=2434; Antisense; CTTCATCCGCAACGATTTTCCAAGG
>probe:Drosophila_2:1633533_at:322:563; Interrogation_Position=2457; Antisense; GGAAGTACCCTAAATATTGCAACTC
>probe:Drosophila_2:1633533_at:392:359; Interrogation_Position=2475; Antisense; GCAACTCAAGCACATCCAGAACAAA
>probe:Drosophila_2:1633533_at:227:455; Interrogation_Position=2535; Antisense; GATCACGCAATCTTTATAAACTGCA
>probe:Drosophila_2:1633533_at:47:161; Interrogation_Position=2578; Antisense; AAATCGTTAAATCACCTTTCAGCGT
>probe:Drosophila_2:1633533_at:642:275; Interrogation_Position=2593; Antisense; CTTTCAGCGTGAATCATATCATTGA
>probe:Drosophila_2:1633533_at:115:23; Interrogation_Position=2608; Antisense; ATATCATTGAGCTTTGCTTCACAAG

Paste this into a BLAST search page for me
GCGAGAGCATATGTAGATAAACCTATAACAAACACTAGCCGTTGGTATCGTAGCCGTTGGTATCGTAATAGTGAACAATACCCCATTAACTAGTCACAGTTAGTCACAGTACTTAAGGTTCCACAGTTCCACAACTAAACCGATTACGATATTTCGATTTTGTTCTTCATCCGCACTTCATCCGCAACGATTTTCCAAGGGGAAGTACCCTAAATATTGCAACTCGCAACTCAAGCACATCCAGAACAAAGATCACGCAATCTTTATAAACTGCAAAATCGTTAAATCACCTTTCAGCGTCTTTCAGCGTGAATCATATCATTGAATATCATTGAGCTTTGCTTCACAAG

Full Affymetrix probeset data:

Annotations for 1633533_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720