Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633535_at:

>probe:Drosophila_2:1633535_at:565:75; Interrogation_Position=1229; Antisense; AGGAGTGCCGTAACATCGTCTGGAT
>probe:Drosophila_2:1633535_at:640:545; Interrogation_Position=1250; Antisense; GGATCGCCGAGTGCGTTGCCCAGAA
>probe:Drosophila_2:1633535_at:583:97; Interrogation_Position=1286; Antisense; AGATCGACAACTACATACCCATTTT
>probe:Drosophila_2:1633535_at:469:27; Interrogation_Position=1300; Antisense; ATACCCATTTTCTAAGCGCGCTAGA
>probe:Drosophila_2:1633535_at:553:323; Interrogation_Position=1315; Antisense; GCGCGCTAGATGATCGCTAAGCATT
>probe:Drosophila_2:1633535_at:405:631; Interrogation_Position=1371; Antisense; TCCTGCCTTTCGATATGCGTTTTTT
>probe:Drosophila_2:1633535_at:357:497; Interrogation_Position=1402; Antisense; GTCCCTCTACCCTTGTTATTGAATT
>probe:Drosophila_2:1633535_at:469:485; Interrogation_Position=1472; Antisense; GTAGCGAGTATTATTGCCGGTCCAG
>probe:Drosophila_2:1633535_at:84:319; Interrogation_Position=1487; Antisense; GCCGGTCCAGGCAAATTTTTGTCAA
>probe:Drosophila_2:1633535_at:399:725; Interrogation_Position=1505; Antisense; TTGTCAAGTGTTCAGACCCAAGCCT
>probe:Drosophila_2:1633535_at:161:205; Interrogation_Position=1524; Antisense; AAGCCTAGATTTCTCAGTTTCCGCG
>probe:Drosophila_2:1633535_at:352:631; Interrogation_Position=1551; Antisense; TCCTCCTCCAATTGTTATCAGCATT
>probe:Drosophila_2:1633535_at:11:533; Interrogation_Position=1608; Antisense; GGAGACCCATAGTGTCCCTTCAGGG
>probe:Drosophila_2:1633535_at:387:647; Interrogation_Position=1627; Antisense; TCAGGGCTTCGTGTTTGTGTACATA

Paste this into a BLAST search page for me
AGGAGTGCCGTAACATCGTCTGGATGGATCGCCGAGTGCGTTGCCCAGAAAGATCGACAACTACATACCCATTTTATACCCATTTTCTAAGCGCGCTAGAGCGCGCTAGATGATCGCTAAGCATTTCCTGCCTTTCGATATGCGTTTTTTGTCCCTCTACCCTTGTTATTGAATTGTAGCGAGTATTATTGCCGGTCCAGGCCGGTCCAGGCAAATTTTTGTCAATTGTCAAGTGTTCAGACCCAAGCCTAAGCCTAGATTTCTCAGTTTCCGCGTCCTCCTCCAATTGTTATCAGCATTGGAGACCCATAGTGTCCCTTCAGGGTCAGGGCTTCGTGTTTGTGTACATA

Full Affymetrix probeset data:

Annotations for 1633535_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime