FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633536_at:

>probe:Drosophila_2:1633536_at:91:691; Interrogation_Position=1568; Antisense; TTTGCCTCGTAGAGATACCCGGCTA
>probe:Drosophila_2:1633536_at:136:67; Interrogation_Position=1602; Antisense; ATGGCTGTTCCTGCGGAGATTTGGA
>probe:Drosophila_2:1633536_at:301:19; Interrogation_Position=1620; Antisense; ATTTGGACGACGTGTGGCACTTTCT
>probe:Drosophila_2:1633536_at:130:621; Interrogation_Position=1655; Antisense; TGCTCTGCTCTATCACGTGTGTGGC
>probe:Drosophila_2:1633536_at:317:581; Interrogation_Position=1676; Antisense; TGGCCAGCGGATTCGTTACACTAGG
>probe:Drosophila_2:1633536_at:133:197; Interrogation_Position=1705; Antisense; AACTGGCTGGTTGTGACGCTCTTTC
>probe:Drosophila_2:1633536_at:206:135; Interrogation_Position=1720; Antisense; ACGCTCTTTCTGGTCGGAAAACTGG
>probe:Drosophila_2:1633536_at:32:695; Interrogation_Position=1759; Antisense; TTTGCAGTCATCTACACGTTCACAG
>probe:Drosophila_2:1633536_at:659:605; Interrogation_Position=1790; Antisense; TGATGCCCACGGTCATTAGGAGCGG
>probe:Drosophila_2:1633536_at:8:467; Interrogation_Position=1819; Antisense; GTTGGTGTGATGTCCACATTTGCCC
>probe:Drosophila_2:1633536_at:44:717; Interrogation_Position=1846; Antisense; TTCGGTGCAATGCTGGCTCCATTTG
>probe:Drosophila_2:1633536_at:285:3; Interrogation_Position=1878; Antisense; ATTGGCTTCGTACTATGACCCACTA
>probe:Drosophila_2:1633536_at:244:281; Interrogation_Position=1904; Antisense; CTCTGCTACTTTTCGGGACACTATC
>probe:Drosophila_2:1633536_at:477:557; Interrogation_Position=1919; Antisense; GGACACTATCGCTCGTGGCTGGACT

Paste this into a BLAST search page for me
TTTGCCTCGTAGAGATACCCGGCTAATGGCTGTTCCTGCGGAGATTTGGAATTTGGACGACGTGTGGCACTTTCTTGCTCTGCTCTATCACGTGTGTGGCTGGCCAGCGGATTCGTTACACTAGGAACTGGCTGGTTGTGACGCTCTTTCACGCTCTTTCTGGTCGGAAAACTGGTTTGCAGTCATCTACACGTTCACAGTGATGCCCACGGTCATTAGGAGCGGGTTGGTGTGATGTCCACATTTGCCCTTCGGTGCAATGCTGGCTCCATTTGATTGGCTTCGTACTATGACCCACTACTCTGCTACTTTTCGGGACACTATCGGACACTATCGCTCGTGGCTGGACT

Full Affymetrix probeset data:

Annotations for 1633536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720