Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633540_at:

>probe:Drosophila_2:1633540_at:123:683; Interrogation_Position=1284; Antisense; TTTGCCAGGAGTCACACGAGTACGG
>probe:Drosophila_2:1633540_at:410:679; Interrogation_Position=1321; Antisense; TAGTGGTCAGTTCGGATCACTCGCA
>probe:Drosophila_2:1633540_at:484:271; Interrogation_Position=1394; Antisense; CATCAATGACGGACAGCTGGCGGCG
>probe:Drosophila_2:1633540_at:215:331; Interrogation_Position=1413; Antisense; GCGGCGGATGATCTTCCATATGCCA
>probe:Drosophila_2:1633540_at:89:25; Interrogation_Position=1430; Antisense; ATATGCCACTCTGAGCTATGCCAAT
>probe:Drosophila_2:1633540_at:466:419; Interrogation_Position=1442; Antisense; GAGCTATGCCAATGGACCGGGCTAT
>probe:Drosophila_2:1633540_at:322:193; Interrogation_Position=1473; Antisense; AACTACCTCAGGGAAGGCGGCGCTG
>probe:Drosophila_2:1633540_at:589:185; Interrogation_Position=1533; Antisense; AACAAGGACTTCATGTTCCCCAGCA
>probe:Drosophila_2:1633540_at:370:111; Interrogation_Position=1554; Antisense; AGCACAGTTCCCTTGGAATCGGAAA
>probe:Drosophila_2:1633540_at:517:575; Interrogation_Position=1597; Antisense; TGGCCGTTTTTGCTAGTGGACCGTA
>probe:Drosophila_2:1633540_at:133:683; Interrogation_Position=1620; Antisense; TATGCCCAGCTTTTCACCGGAGTTT
>probe:Drosophila_2:1633540_at:152:131; Interrogation_Position=1635; Antisense; ACCGGAGTTTTCGAGCAGCATTTCA
>probe:Drosophila_2:1633540_at:297:721; Interrogation_Position=1685; Antisense; TTGCCTCAGTGATCGTAACATGTGC
>probe:Drosophila_2:1633540_at:468:565; Interrogation_Position=1724; Antisense; GGCACGGAGACCACGCTGAAACTTG

Paste this into a BLAST search page for me
TTTGCCAGGAGTCACACGAGTACGGTAGTGGTCAGTTCGGATCACTCGCACATCAATGACGGACAGCTGGCGGCGGCGGCGGATGATCTTCCATATGCCAATATGCCACTCTGAGCTATGCCAATGAGCTATGCCAATGGACCGGGCTATAACTACCTCAGGGAAGGCGGCGCTGAACAAGGACTTCATGTTCCCCAGCAAGCACAGTTCCCTTGGAATCGGAAATGGCCGTTTTTGCTAGTGGACCGTATATGCCCAGCTTTTCACCGGAGTTTACCGGAGTTTTCGAGCAGCATTTCATTGCCTCAGTGATCGTAACATGTGCGGCACGGAGACCACGCTGAAACTTG

Full Affymetrix probeset data:

Annotations for 1633540_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime