Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633543_s_at:

>probe:Drosophila_2:1633543_s_at:730:297; Interrogation_Position=1031; Antisense; CGCGTCCGCGTATCTGTGTCAGTAG
>probe:Drosophila_2:1633543_s_at:48:515; Interrogation_Position=1046; Antisense; GTGTCAGTAGTGTCCGTGCTCCAGC
>probe:Drosophila_2:1633543_s_at:398:417; Interrogation_Position=1076; Antisense; GAGCTCTAATCCCTACCCGGTATTT
>probe:Drosophila_2:1633543_s_at:26:1; Interrogation_Position=1102; Antisense; GGTCGGTTTCTATGTTTGGTCCACT
>probe:Drosophila_2:1633543_s_at:109:59; Interrogation_Position=1113; Antisense; ATGTTTGGTCCACTGTGACCAGGCG
>probe:Drosophila_2:1633543_s_at:460:77; Interrogation_Position=1203; Antisense; AGGATCCAATCGCAGCCAATCGAAT
>probe:Drosophila_2:1633543_s_at:241:365; Interrogation_Position=1224; Antisense; GAATCGAAACCCAGCCGACTTCATT
>probe:Drosophila_2:1633543_s_at:391:149; Interrogation_Position=1241; Antisense; ACTTCATTTCTGCTCCCAAACATGT
>probe:Drosophila_2:1633543_s_at:425:315; Interrogation_Position=1252; Antisense; GCTCCCAAACATGTTTTTGGCGCAA
>probe:Drosophila_2:1633543_s_at:34:633; Interrogation_Position=824; Antisense; TCCCGTCGTCGAGAAGCATTCAATA
>probe:Drosophila_2:1633543_s_at:312:537; Interrogation_Position=902; Antisense; GGTCTTGATTTACGTTATTCTGCAT
>probe:Drosophila_2:1633543_s_at:668:689; Interrogation_Position=917; Antisense; TATTCTGCATTAGCCCAGTACTCCA
>probe:Drosophila_2:1633543_s_at:21:91; Interrogation_Position=933; Antisense; AGTACTCCATGAGCTATTTCTCCTC
>probe:Drosophila_2:1633543_s_at:713:145; Interrogation_Position=986; Antisense; ACTCTACTCTTTTTGTCTCACACAC

Paste this into a BLAST search page for me
CGCGTCCGCGTATCTGTGTCAGTAGGTGTCAGTAGTGTCCGTGCTCCAGCGAGCTCTAATCCCTACCCGGTATTTGGTCGGTTTCTATGTTTGGTCCACTATGTTTGGTCCACTGTGACCAGGCGAGGATCCAATCGCAGCCAATCGAATGAATCGAAACCCAGCCGACTTCATTACTTCATTTCTGCTCCCAAACATGTGCTCCCAAACATGTTTTTGGCGCAATCCCGTCGTCGAGAAGCATTCAATAGGTCTTGATTTACGTTATTCTGCATTATTCTGCATTAGCCCAGTACTCCAAGTACTCCATGAGCTATTTCTCCTCACTCTACTCTTTTTGTCTCACACAC

Full Affymetrix probeset data:

Annotations for 1633543_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime