Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633544_at:

>probe:Drosophila_2:1633544_at:544:225; Interrogation_Position=1308; Antisense; AAGGACCCCTGGAAGCTATACCGCT
>probe:Drosophila_2:1633544_at:729:685; Interrogation_Position=1324; Antisense; TATACCGCTGCCACTCGATCATGAA
>probe:Drosophila_2:1633544_at:230:453; Interrogation_Position=1340; Antisense; GATCATGAACTGCACCAACACGTGC
>probe:Drosophila_2:1633544_at:554:207; Interrogation_Position=1368; Antisense; AAGCACCTCAATCCGGCTAGAGCCA
>probe:Drosophila_2:1633544_at:206:287; Interrogation_Position=1381; Antisense; CGGCTAGAGCCATCATTCAGCTGAA
>probe:Drosophila_2:1633544_at:535:415; Interrogation_Position=1387; Antisense; GAGCCATCATTCAGCTGAAGCAGCT
>probe:Drosophila_2:1633544_at:214:209; Interrogation_Position=1404; Antisense; AAGCAGCTGCTTGTGGGACTGAAGA
>probe:Drosophila_2:1633544_at:145:387; Interrogation_Position=1435; Antisense; GAAAACCACAACTCAAGACCGACGC
>probe:Drosophila_2:1633544_at:713:241; Interrogation_Position=1493; Antisense; AATATCGACATAACGCCATGGGACT
>probe:Drosophila_2:1633544_at:682:659; Interrogation_Position=1503; Antisense; TAACGCCATGGGACTTAATAGATAT
>probe:Drosophila_2:1633544_at:544:367; Interrogation_Position=1778; Antisense; GAATGCTATACTGTACACACTGGGC
>probe:Drosophila_2:1633544_at:46:527; Interrogation_Position=1799; Antisense; GGGCAATACACCGATACATCCTATT
>probe:Drosophila_2:1633544_at:573:455; Interrogation_Position=1811; Antisense; GATACATCCTATTAACTACATTTTA
>probe:Drosophila_2:1633544_at:493:75; Interrogation_Position=1840; Antisense; AGGACCTCATGGACTTTACGTTAGA

Paste this into a BLAST search page for me
AAGGACCCCTGGAAGCTATACCGCTTATACCGCTGCCACTCGATCATGAAGATCATGAACTGCACCAACACGTGCAAGCACCTCAATCCGGCTAGAGCCACGGCTAGAGCCATCATTCAGCTGAAGAGCCATCATTCAGCTGAAGCAGCTAAGCAGCTGCTTGTGGGACTGAAGAGAAAACCACAACTCAAGACCGACGCAATATCGACATAACGCCATGGGACTTAACGCCATGGGACTTAATAGATATGAATGCTATACTGTACACACTGGGCGGGCAATACACCGATACATCCTATTGATACATCCTATTAACTACATTTTAAGGACCTCATGGACTTTACGTTAGA

Full Affymetrix probeset data:

Annotations for 1633544_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime