FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633545_at:

>probe:Drosophila_2:1633545_at:362:675; Interrogation_Position=122; Antisense; TAGACAGCATGGAAACTCCCTTGCC
>probe:Drosophila_2:1633545_at:301:403; Interrogation_Position=15; Antisense; GACTTGGATCGGTTTGCTCATCGTT
>probe:Drosophila_2:1633545_at:295:597; Interrogation_Position=153; Antisense; TGTGATCGCCCATACAGCTGGAGGA
>probe:Drosophila_2:1633545_at:418:331; Interrogation_Position=184; Antisense; GCGGATGATGTTACATGCTCCCAGC
>probe:Drosophila_2:1633545_at:259:179; Interrogation_Position=245; Antisense; AAAAGTTCTCGGACATTGGCTACCA
>probe:Drosophila_2:1633545_at:593:3; Interrogation_Position=259; Antisense; ATTGGCTACCACTATCTGATCGGCG
>probe:Drosophila_2:1633545_at:104:101; Interrogation_Position=320; Antisense; AGAGAGGAGCCTTTGCCGGTCCCAA
>probe:Drosophila_2:1633545_at:221:239; Interrogation_Position=342; Antisense; CAATAACGATGGTTCCCTGGGCATT
>probe:Drosophila_2:1633545_at:168:217; Interrogation_Position=475; Antisense; AAGTTACTGGGCCATCGTCAAGTCA
>probe:Drosophila_2:1633545_at:359:653; Interrogation_Position=492; Antisense; TCAAGTCAGTGCTACCAAGAGTCCT
>probe:Drosophila_2:1633545_at:27:589; Interrogation_Position=516; Antisense; TGGAGAAGCACTCTACGCTCTGATA
>probe:Drosophila_2:1633545_at:436:135; Interrogation_Position=530; Antisense; ACGCTCTGATACAGCAGTGGCCCAA
>probe:Drosophila_2:1633545_at:647:83; Interrogation_Position=545; Antisense; AGTGGCCCAACTGGTCCGAAGAAAT
>probe:Drosophila_2:1633545_at:11:521; Interrogation_Position=93; Antisense; GTGGAATGCCAAACCGCCGAACGGA

Paste this into a BLAST search page for me
TAGACAGCATGGAAACTCCCTTGCCGACTTGGATCGGTTTGCTCATCGTTTGTGATCGCCCATACAGCTGGAGGAGCGGATGATGTTACATGCTCCCAGCAAAAGTTCTCGGACATTGGCTACCAATTGGCTACCACTATCTGATCGGCGAGAGAGGAGCCTTTGCCGGTCCCAACAATAACGATGGTTCCCTGGGCATTAAGTTACTGGGCCATCGTCAAGTCATCAAGTCAGTGCTACCAAGAGTCCTTGGAGAAGCACTCTACGCTCTGATAACGCTCTGATACAGCAGTGGCCCAAAGTGGCCCAACTGGTCCGAAGAAATGTGGAATGCCAAACCGCCGAACGGA

Full Affymetrix probeset data:

Annotations for 1633545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720