FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633546_at:

>probe:Drosophila_2:1633546_at:439:651; Interrogation_Position=1022; Antisense; TCAATCAGAACTTGCAGCTGCCCAA
>probe:Drosophila_2:1633546_at:110:89; Interrogation_Position=1037; Antisense; AGCTGCCCAACCGTTTGAAATTCGC
>probe:Drosophila_2:1633546_at:299:163; Interrogation_Position=1054; Antisense; AAATTCGCCCAGGTGCAATTGTGGA
>probe:Drosophila_2:1633546_at:673:519; Interrogation_Position=1074; Antisense; GTGGAGCCGTGATTACTGCAATTCT
>probe:Drosophila_2:1633546_at:163:45; Interrogation_Position=1121; Antisense; ATCGCATGGTGTGTGCAGGACATCC
>probe:Drosophila_2:1633546_at:500:67; Interrogation_Position=1199; Antisense; ATGGCAAGCTCTTCGGTGTGGTGTC
>probe:Drosophila_2:1633546_at:556:725; Interrogation_Position=724; Antisense; TTGATCTCCGACACCATGATCGTGA
>probe:Drosophila_2:1633546_at:654:63; Interrogation_Position=766; Antisense; ATGGGCCAGAATCCCGGTCAGATGA
>probe:Drosophila_2:1633546_at:694:157; Interrogation_Position=805; Antisense; ACAAACGATCTGAGCGCCGGAAATG
>probe:Drosophila_2:1633546_at:224:227; Interrogation_Position=826; Antisense; AATGGTCAGACCTTCAACATTGCCC
>probe:Drosophila_2:1633546_at:411:189; Interrogation_Position=841; Antisense; AACATTGCCCAGTTCATCATACATC
>probe:Drosophila_2:1633546_at:470:1; Interrogation_Position=907; Antisense; ATTAAGTTGAGCAGCCCGGTTCCGA
>probe:Drosophila_2:1633546_at:476:527; Interrogation_Position=933; Antisense; GGGAGGAGCTGTACAAACCATTCAA
>probe:Drosophila_2:1633546_at:397:195; Interrogation_Position=956; Antisense; AACTGGCAGATTCGGACTCCAACTA

Paste this into a BLAST search page for me
TCAATCAGAACTTGCAGCTGCCCAAAGCTGCCCAACCGTTTGAAATTCGCAAATTCGCCCAGGTGCAATTGTGGAGTGGAGCCGTGATTACTGCAATTCTATCGCATGGTGTGTGCAGGACATCCATGGCAAGCTCTTCGGTGTGGTGTCTTGATCTCCGACACCATGATCGTGAATGGGCCAGAATCCCGGTCAGATGAACAAACGATCTGAGCGCCGGAAATGAATGGTCAGACCTTCAACATTGCCCAACATTGCCCAGTTCATCATACATCATTAAGTTGAGCAGCCCGGTTCCGAGGGAGGAGCTGTACAAACCATTCAAAACTGGCAGATTCGGACTCCAACTA

Full Affymetrix probeset data:

Annotations for 1633546_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720