Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633547_a_at:

>probe:Drosophila_2:1633547_a_at:449:665; Interrogation_Position=238; Antisense; TACAAGCTGTACAAATCCCTGACGG
>probe:Drosophila_2:1633547_a_at:156:207; Interrogation_Position=241; Antisense; AAGCTGTACAAATCCCTGACGGAAA
>probe:Drosophila_2:1633547_a_at:644:133; Interrogation_Position=248; Antisense; ACAAATCCCTGACGGAAAAGGAGCT
>probe:Drosophila_2:1633547_a_at:639:265; Interrogation_Position=280; Antisense; CAGGAGAAACTGAAGAGCAAGCAAC
>probe:Drosophila_2:1633547_a_at:123:421; Interrogation_Position=294; Antisense; GAGCAAGCAACAGAAGAAGGCCAAG
>probe:Drosophila_2:1633547_a_at:266:369; Interrogation_Position=309; Antisense; GAAGGCCAAGAAGTCAAACTGAAGG
>probe:Drosophila_2:1633547_a_at:403:587; Interrogation_Position=337; Antisense; TGGAGGCGAGGATATCATTGACGTA
>probe:Drosophila_2:1633547_a_at:158:37; Interrogation_Position=350; Antisense; ATCATTGACGTAGTGCACTTTCCGG
>probe:Drosophila_2:1633547_a_at:319:485; Interrogation_Position=359; Antisense; GTAGTGCACTTTCCGGCCCTGAGAC
>probe:Drosophila_2:1633547_a_at:7:303; Interrogation_Position=375; Antisense; CCCTGAGACCTTCCATCTTGTTAAT
>probe:Drosophila_2:1633547_a_at:414:425; Interrogation_Position=379; Antisense; GAGACCTTCCATCTTGTTAATCAAT
>probe:Drosophila_2:1633547_a_at:154:655; Interrogation_Position=396; Antisense; TAATCAATACAATCGCCCTGTAAAT
>probe:Drosophila_2:1633547_a_at:236:665; Interrogation_Position=403; Antisense; TACAATCGCCCTGTAAATGACTAAA
>probe:Drosophila_2:1633547_a_at:530:401; Interrogation_Position=421; Antisense; GACTAAATCATAAACCAGTAAACGT

Paste this into a BLAST search page for me
TACAAGCTGTACAAATCCCTGACGGAAGCTGTACAAATCCCTGACGGAAAACAAATCCCTGACGGAAAAGGAGCTCAGGAGAAACTGAAGAGCAAGCAACGAGCAAGCAACAGAAGAAGGCCAAGGAAGGCCAAGAAGTCAAACTGAAGGTGGAGGCGAGGATATCATTGACGTAATCATTGACGTAGTGCACTTTCCGGGTAGTGCACTTTCCGGCCCTGAGACCCCTGAGACCTTCCATCTTGTTAATGAGACCTTCCATCTTGTTAATCAATTAATCAATACAATCGCCCTGTAAATTACAATCGCCCTGTAAATGACTAAAGACTAAATCATAAACCAGTAAACGT

Full Affymetrix probeset data:

Annotations for 1633547_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime