Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633549_s_at:

>probe:Drosophila_2:1633549_s_at:636:147; Interrogation_Position=300; Antisense; ACTACGAGAGCGTCAACGAGTGCAT
>probe:Drosophila_2:1633549_s_at:498:269; Interrogation_Position=322; Antisense; CATGGAGGGCGTGTGCAAGATCTAC
>probe:Drosophila_2:1633549_s_at:247:437; Interrogation_Position=347; Antisense; GAGGAGCACCTGAAGCGCCGCAATC
>probe:Drosophila_2:1633549_s_at:725:179; Interrogation_Position=373; Antisense; AAACACTCCGACCATTACGTATGAC
>probe:Drosophila_2:1633549_s_at:698:13; Interrogation_Position=398; Antisense; ATTAGCCAGCTATTCGATTTCATCG
>probe:Drosophila_2:1633549_s_at:451:519; Interrogation_Position=431; Antisense; GTGGACATTAGCTGCATGGTTTACC
>probe:Drosophila_2:1633549_s_at:623:673; Interrogation_Position=469; Antisense; TACCTATGCGCCCTACAATAAGGAT
>probe:Drosophila_2:1633549_s_at:4:293; Interrogation_Position=524; Antisense; CGTCAGGCGGCATTTAGTTCCAATA
>probe:Drosophila_2:1633549_s_at:349:25; Interrogation_Position=546; Antisense; ATACCTAAAGGGACGGCGATGCGAC
>probe:Drosophila_2:1633549_s_at:321:435; Interrogation_Position=698; Antisense; GAGGATACATGCAACAGCGCTTGGA
>probe:Drosophila_2:1633549_s_at:273:123; Interrogation_Position=713; Antisense; AGCGCTTGGAACAGCATCCGCAACG
>probe:Drosophila_2:1633549_s_at:657:463; Interrogation_Position=814; Antisense; GATTCCATTGGAGACTTGCTGCTAC
>probe:Drosophila_2:1633549_s_at:499:621; Interrogation_Position=830; Antisense; TGCTGCTACCGACTAGATCGCCAAA
>probe:Drosophila_2:1633549_s_at:572:447; Interrogation_Position=845; Antisense; GATCGCCAAATGACAGCAACTTTTT

Paste this into a BLAST search page for me
ACTACGAGAGCGTCAACGAGTGCATCATGGAGGGCGTGTGCAAGATCTACGAGGAGCACCTGAAGCGCCGCAATCAAACACTCCGACCATTACGTATGACATTAGCCAGCTATTCGATTTCATCGGTGGACATTAGCTGCATGGTTTACCTACCTATGCGCCCTACAATAAGGATCGTCAGGCGGCATTTAGTTCCAATAATACCTAAAGGGACGGCGATGCGACGAGGATACATGCAACAGCGCTTGGAAGCGCTTGGAACAGCATCCGCAACGGATTCCATTGGAGACTTGCTGCTACTGCTGCTACCGACTAGATCGCCAAAGATCGCCAAATGACAGCAACTTTTT

Full Affymetrix probeset data:

Annotations for 1633549_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime