FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633551_at:

>probe:Drosophila_2:1633551_at:394:111; Interrogation_Position=325; Antisense; AGCAATCGCGATCTCGAGCACTTGT
>probe:Drosophila_2:1633551_at:368:415; Interrogation_Position=379; Antisense; GAGCGGTTCCTCAACTTTGTCCATA
>probe:Drosophila_2:1633551_at:529:691; Interrogation_Position=394; Antisense; TTTGTCCATAGTCACCAGCTGCAGG
>probe:Drosophila_2:1633551_at:506:199; Interrogation_Position=421; Antisense; AACCTACCACGGTTGCTGCGGTTTG
>probe:Drosophila_2:1633551_at:686:369; Interrogation_Position=453; Antisense; GAATGTCCAGGATTGGCTGCTGCAC
>probe:Drosophila_2:1633551_at:532:335; Interrogation_Position=471; Antisense; GCTGCACGTGGTCGGCTACTTTATG
>probe:Drosophila_2:1633551_at:599:699; Interrogation_Position=490; Antisense; TTTATGCCAGCCAGCGAAAGCGAGG
>probe:Drosophila_2:1633551_at:386:169; Interrogation_Position=537; Antisense; AAAGTATCTGGGACCCTTCATTGCC
>probe:Drosophila_2:1633551_at:493:5; Interrogation_Position=556; Antisense; ATTGCCGCCGTTCTGTTAAAGACCG
>probe:Drosophila_2:1633551_at:319:343; Interrogation_Position=595; Antisense; GCATACCACTCCATTGCCATTGTAG
>probe:Drosophila_2:1633551_at:675:329; Interrogation_Position=701; Antisense; GCGGCGAGAAGACCACCTACGAGAT
>probe:Drosophila_2:1633551_at:90:671; Interrogation_Position=718; Antisense; TACGAGATCGTCAAGCATCCGCAGG
>probe:Drosophila_2:1633551_at:49:523; Interrogation_Position=794; Antisense; GTGGCCATGACGGAGGATCCTACCA
>probe:Drosophila_2:1633551_at:651:73; Interrogation_Position=848; Antisense; AGGACAAGGCTTACCAGGCCTGGAT

Paste this into a BLAST search page for me
AGCAATCGCGATCTCGAGCACTTGTGAGCGGTTCCTCAACTTTGTCCATATTTGTCCATAGTCACCAGCTGCAGGAACCTACCACGGTTGCTGCGGTTTGGAATGTCCAGGATTGGCTGCTGCACGCTGCACGTGGTCGGCTACTTTATGTTTATGCCAGCCAGCGAAAGCGAGGAAAGTATCTGGGACCCTTCATTGCCATTGCCGCCGTTCTGTTAAAGACCGGCATACCACTCCATTGCCATTGTAGGCGGCGAGAAGACCACCTACGAGATTACGAGATCGTCAAGCATCCGCAGGGTGGCCATGACGGAGGATCCTACCAAGGACAAGGCTTACCAGGCCTGGAT

Full Affymetrix probeset data:

Annotations for 1633551_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720