Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633554_at:

>probe:Drosophila_2:1633554_at:353:199; Interrogation_Position=4194; Antisense; AACCGTAAAGACTTGACCTGCTACT
>probe:Drosophila_2:1633554_at:381:413; Interrogation_Position=4208; Antisense; GACCTGCTACTTAAGATACTCGCAA
>probe:Drosophila_2:1633554_at:322:255; Interrogation_Position=4235; Antisense; CAAACCGTACACAAAACTCGCTCAA
>probe:Drosophila_2:1633554_at:114:171; Interrogation_Position=4258; Antisense; AAAGTGTTGACCTAAGTCTCCGCAT
>probe:Drosophila_2:1633554_at:500:499; Interrogation_Position=4273; Antisense; GTCTCCGCATTGTTTAACTTGTACA
>probe:Drosophila_2:1633554_at:39:181; Interrogation_Position=4360; Antisense; AAACACTATTGTGTCTTCCCTCGAA
>probe:Drosophila_2:1633554_at:214:515; Interrogation_Position=4370; Antisense; GTGTCTTCCCTCGAATTTTAATTGA
>probe:Drosophila_2:1633554_at:651:607; Interrogation_Position=4392; Antisense; TGACCTTCGATACCAATTACAACAT
>probe:Drosophila_2:1633554_at:386:29; Interrogation_Position=4415; Antisense; ATACGTACTCCATACCCAAGTGTTA
>probe:Drosophila_2:1633554_at:306:723; Interrogation_Position=4504; Antisense; TTGCGCTAATCCAATACTCATTTTG
>probe:Drosophila_2:1633554_at:239:351; Interrogation_Position=4602; Antisense; GCAGTTTGCACTGTACTCCGAGTAA
>probe:Drosophila_2:1633554_at:246:485; Interrogation_Position=4648; Antisense; GTATGTTCCCTCAATATCAGCGTGT
>probe:Drosophila_2:1633554_at:84:209; Interrogation_Position=4695; Antisense; AAGCATACATATTCCGCCAAATCGC
>probe:Drosophila_2:1633554_at:519:165; Interrogation_Position=4713; Antisense; AAATCGCTCGGCATGGCTTTGTGTG

Paste this into a BLAST search page for me
AACCGTAAAGACTTGACCTGCTACTGACCTGCTACTTAAGATACTCGCAACAAACCGTACACAAAACTCGCTCAAAAAGTGTTGACCTAAGTCTCCGCATGTCTCCGCATTGTTTAACTTGTACAAAACACTATTGTGTCTTCCCTCGAAGTGTCTTCCCTCGAATTTTAATTGATGACCTTCGATACCAATTACAACATATACGTACTCCATACCCAAGTGTTATTGCGCTAATCCAATACTCATTTTGGCAGTTTGCACTGTACTCCGAGTAAGTATGTTCCCTCAATATCAGCGTGTAAGCATACATATTCCGCCAAATCGCAAATCGCTCGGCATGGCTTTGTGTG

Full Affymetrix probeset data:

Annotations for 1633554_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime