FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633555_at:

>probe:Drosophila_2:1633555_at:678:137; Interrogation_Position=1077; Antisense; ACGTCAAAAGTTTCTGCGGTCTGCC
>probe:Drosophila_2:1633555_at:294:495; Interrogation_Position=1079; Antisense; GTCAAAAGTTTCTGCGGTCTGCCAG
>probe:Drosophila_2:1633555_at:658:171; Interrogation_Position=1083; Antisense; AAAGTTTCTGCGGTCTGCCAGCTCA
>probe:Drosophila_2:1633555_at:699:91; Interrogation_Position=1085; Antisense; AGTTTCTGCGGTCTGCCAGCTCATC
>probe:Drosophila_2:1633555_at:564:47; Interrogation_Position=1107; Antisense; ATCCACCCTTAGCACCGCTGATGTG
>probe:Drosophila_2:1633555_at:639:275; Interrogation_Position=1114; Antisense; CTTAGCACCGCTGATGTGTTGGCAT
>probe:Drosophila_2:1633555_at:518:675; Interrogation_Position=1116; Antisense; TAGCACCGCTGATGTGTTGGCATTT
>probe:Drosophila_2:1633555_at:127:133; Interrogation_Position=1120; Antisense; ACCGCTGATGTGTTGGCATTTGCTT
>probe:Drosophila_2:1633555_at:708:441; Interrogation_Position=1126; Antisense; GATGTGTTGGCATTTGCTTTTGCTT
>probe:Drosophila_2:1633555_at:705:599; Interrogation_Position=1130; Antisense; TGTTGGCATTTGCTTTTGCTTTTAC
>probe:Drosophila_2:1633555_at:227:343; Interrogation_Position=1141; Antisense; GCTTTTGCTTTTACTCGCTGGCTGC
>probe:Drosophila_2:1633555_at:522:615; Interrogation_Position=1146; Antisense; TGCTTTTACTCGCTGGCTGCTTTAA
>probe:Drosophila_2:1633555_at:84:709; Interrogation_Position=881; Antisense; TTAAGGCTTATACGACGGATTCCCT
>probe:Drosophila_2:1633555_at:361:63; Interrogation_Position=884; Antisense; AGGCTTATACGACGGATTCCCTCAG

Paste this into a BLAST search page for me
ACGTCAAAAGTTTCTGCGGTCTGCCGTCAAAAGTTTCTGCGGTCTGCCAGAAAGTTTCTGCGGTCTGCCAGCTCAAGTTTCTGCGGTCTGCCAGCTCATCATCCACCCTTAGCACCGCTGATGTGCTTAGCACCGCTGATGTGTTGGCATTAGCACCGCTGATGTGTTGGCATTTACCGCTGATGTGTTGGCATTTGCTTGATGTGTTGGCATTTGCTTTTGCTTTGTTGGCATTTGCTTTTGCTTTTACGCTTTTGCTTTTACTCGCTGGCTGCTGCTTTTACTCGCTGGCTGCTTTAATTAAGGCTTATACGACGGATTCCCTAGGCTTATACGACGGATTCCCTCAG

Full Affymetrix probeset data:

Annotations for 1633555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720