Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633557_at:

>probe:Drosophila_2:1633557_at:179:607; Interrogation_Position=2160; Antisense; TGAGTACAATCGTGTTGTCGCCTGT
>probe:Drosophila_2:1633557_at:205:599; Interrogation_Position=2175; Antisense; TGTCGCCTGTGTCCAAAACTTCATT
>probe:Drosophila_2:1633557_at:510:711; Interrogation_Position=2194; Antisense; TTCATTGCAAATCAGGTGTCCGCCG
>probe:Drosophila_2:1633557_at:70:319; Interrogation_Position=2215; Antisense; GCCGTCTATGTGCATCTCATCAAGG
>probe:Drosophila_2:1633557_at:540:443; Interrogation_Position=2257; Antisense; GATGATCACGAGCTACTGGCCATTC
>probe:Drosophila_2:1633557_at:708:145; Interrogation_Position=2310; Antisense; ACTCTGCAAGAGCTTATGGCCCATT
>probe:Drosophila_2:1633557_at:219:273; Interrogation_Position=2331; Antisense; CATTGTTCCCTTCCTGGTGGAGGAA
>probe:Drosophila_2:1633557_at:591:553; Interrogation_Position=2360; Antisense; GGAGCTACTATGACACCACAGGTGG
>probe:Drosophila_2:1633557_at:383:535; Interrogation_Position=2383; Antisense; GGTGCATTCCACGAGCAAATTGTTC
>probe:Drosophila_2:1633557_at:501:99; Interrogation_Position=2496; Antisense; AGATGTTAACACCTGGCACTTGGCC
>probe:Drosophila_2:1633557_at:415:355; Interrogation_Position=2511; Antisense; GCACTTGGCCGTGACCATCAAAGGA
>probe:Drosophila_2:1633557_at:519:421; Interrogation_Position=2564; Antisense; GAGAACTTCACAGCCCTCTTGGAGA
>probe:Drosophila_2:1633557_at:486:551; Interrogation_Position=2584; Antisense; GGAGAGTCTATATCACTGTGCCCAC
>probe:Drosophila_2:1633557_at:630:139; Interrogation_Position=2644; Antisense; ACGTGTCAACGTTGCTCTGACGTTA

Paste this into a BLAST search page for me
TGAGTACAATCGTGTTGTCGCCTGTTGTCGCCTGTGTCCAAAACTTCATTTTCATTGCAAATCAGGTGTCCGCCGGCCGTCTATGTGCATCTCATCAAGGGATGATCACGAGCTACTGGCCATTCACTCTGCAAGAGCTTATGGCCCATTCATTGTTCCCTTCCTGGTGGAGGAAGGAGCTACTATGACACCACAGGTGGGGTGCATTCCACGAGCAAATTGTTCAGATGTTAACACCTGGCACTTGGCCGCACTTGGCCGTGACCATCAAAGGAGAGAACTTCACAGCCCTCTTGGAGAGGAGAGTCTATATCACTGTGCCCACACGTGTCAACGTTGCTCTGACGTTA

Full Affymetrix probeset data:

Annotations for 1633557_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime