FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633559_at:

>probe:Drosophila_2:1633559_at:627:553; Interrogation_Position=207; Antisense; GGACCAAAGTCTTCGATACCGTGGA
>probe:Drosophila_2:1633559_at:320:535; Interrogation_Position=253; Antisense; GGTCAATATTTTCGTGGGTGCTGTT
>probe:Drosophila_2:1633559_at:550:507; Interrogation_Position=270; Antisense; GTGCTGTTGGTCTGTGCGCCATCTA
>probe:Drosophila_2:1633559_at:215:323; Interrogation_Position=314; Antisense; GCCCAACTACTGTGCAACATCATTG
>probe:Drosophila_2:1633559_at:106:473; Interrogation_Position=341; Antisense; GTTCTGTACCCTGCATATATTTCCA
>probe:Drosophila_2:1633559_at:428:49; Interrogation_Position=369; Antisense; ATGCCATCGAGTCCAGCACAAAGCA
>probe:Drosophila_2:1633559_at:430:529; Interrogation_Position=420; Antisense; GGGTCACGTTTGGAATCTTCACCGT
>probe:Drosophila_2:1633559_at:579:693; Interrogation_Position=456; Antisense; TTTCGAGTCTGCTAACTTCGGTGAT
>probe:Drosophila_2:1633559_at:72:707; Interrogation_Position=487; Antisense; TTACTGGCTGCTGAAGTGTGCTTTC
>probe:Drosophila_2:1633559_at:476:37; Interrogation_Position=557; Antisense; ATCTACAACAAGCTGGTGCGACCCT
>probe:Drosophila_2:1633559_at:190:393; Interrogation_Position=634; Antisense; GAAAGCCGCTGGAGTGCTGAAGCAT
>probe:Drosophila_2:1633559_at:328:225; Interrogation_Position=665; Antisense; AAGGCGAATGTACCGTAGCTCCGAC
>probe:Drosophila_2:1633559_at:472:343; Interrogation_Position=691; Antisense; GCTTCTCGCTTATCCATGCATTTGG
>probe:Drosophila_2:1633559_at:184:271; Interrogation_Position=705; Antisense; CATGCATTTGGTTTTGGGCCTGGTC

Paste this into a BLAST search page for me
GGACCAAAGTCTTCGATACCGTGGAGGTCAATATTTTCGTGGGTGCTGTTGTGCTGTTGGTCTGTGCGCCATCTAGCCCAACTACTGTGCAACATCATTGGTTCTGTACCCTGCATATATTTCCAATGCCATCGAGTCCAGCACAAAGCAGGGTCACGTTTGGAATCTTCACCGTTTTCGAGTCTGCTAACTTCGGTGATTTACTGGCTGCTGAAGTGTGCTTTCATCTACAACAAGCTGGTGCGACCCTGAAAGCCGCTGGAGTGCTGAAGCATAAGGCGAATGTACCGTAGCTCCGACGCTTCTCGCTTATCCATGCATTTGGCATGCATTTGGTTTTGGGCCTGGTC

Full Affymetrix probeset data:

Annotations for 1633559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720