FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633560_at:

>probe:Drosophila_2:1633560_at:71:315; Interrogation_Position=1348; Antisense; GCCTAGTCGCGAGCGCACTAAGAAG
>probe:Drosophila_2:1633560_at:468:145; Interrogation_Position=1364; Antisense; ACTAAGAAGACCCACCGCAGTCGAT
>probe:Drosophila_2:1633560_at:335:471; Interrogation_Position=1407; Antisense; GTTCGCCGCCGAAGCATAAGAAAAA
>probe:Drosophila_2:1633560_at:351:181; Interrogation_Position=1428; Antisense; AAAAGTCACGTCACTACTCGAGGTC
>probe:Drosophila_2:1633560_at:441:247; Interrogation_Position=1466; Antisense; AATTCGCCGCACAGCAAGCACAGGA
>probe:Drosophila_2:1633560_at:12:217; Interrogation_Position=1490; Antisense; AAGTCGAAATCCTCGCGAGAACGCT
>probe:Drosophila_2:1633560_at:44:109; Interrogation_Position=1507; Antisense; AGAACGCTCTGAATACTACTCCAAG
>probe:Drosophila_2:1633560_at:219:667; Interrogation_Position=1520; Antisense; TACTACTCCAAGAAAGATCGGTCTG
>probe:Drosophila_2:1633560_at:51:451; Interrogation_Position=1535; Antisense; GATCGGTCTGGAAACCCAGGCAGTA
>probe:Drosophila_2:1633560_at:74:359; Interrogation_Position=1560; Antisense; GCAATAATCTAGGTGATGGCGACAA
>probe:Drosophila_2:1633560_at:112:583; Interrogation_Position=1576; Antisense; TGGCGACAAGTATCGCAACTCCGTC
>probe:Drosophila_2:1633560_at:535:245; Interrogation_Position=1604; Antisense; AATTCCGGCAAGCACAGTCGGTACT
>probe:Drosophila_2:1633560_at:31:547; Interrogation_Position=1765; Antisense; GGATCGCAAGCGCTAGTGATTGATA
>probe:Drosophila_2:1633560_at:136:423; Interrogation_Position=1797; Antisense; GAGACAAACACTCCCTTATATTTAA

Paste this into a BLAST search page for me
GCCTAGTCGCGAGCGCACTAAGAAGACTAAGAAGACCCACCGCAGTCGATGTTCGCCGCCGAAGCATAAGAAAAAAAAAGTCACGTCACTACTCGAGGTCAATTCGCCGCACAGCAAGCACAGGAAAGTCGAAATCCTCGCGAGAACGCTAGAACGCTCTGAATACTACTCCAAGTACTACTCCAAGAAAGATCGGTCTGGATCGGTCTGGAAACCCAGGCAGTAGCAATAATCTAGGTGATGGCGACAATGGCGACAAGTATCGCAACTCCGTCAATTCCGGCAAGCACAGTCGGTACTGGATCGCAAGCGCTAGTGATTGATAGAGACAAACACTCCCTTATATTTAA

Full Affymetrix probeset data:

Annotations for 1633560_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720