FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633561_at:

>probe:Drosophila_2:1633561_at:301:473; Interrogation_Position=100; Antisense; GTTACTCGGAGTCTGCTGTTTGAAA
>probe:Drosophila_2:1633561_at:508:711; Interrogation_Position=119; Antisense; TTGAAAATTATTGCATGTCTCCGGG
>probe:Drosophila_2:1633561_at:302:53; Interrogation_Position=13; Antisense; ATGCTTAATGTCATGCAACAACAGC
>probe:Drosophila_2:1633561_at:263:523; Interrogation_Position=142; Antisense; GGGCCAGCAAACTGCAACCTGCCAG
>probe:Drosophila_2:1633561_at:283:203; Interrogation_Position=157; Antisense; AACCTGCCAGAGGAGCAGTCTGCAA
>probe:Drosophila_2:1633561_at:655:615; Interrogation_Position=177; Antisense; TGCAAAGGAGACGACTCCCAACTAT
>probe:Drosophila_2:1633561_at:633:135; Interrogation_Position=187; Antisense; ACGACTCCCAACTATGCCAGATCTG
>probe:Drosophila_2:1633561_at:727:237; Interrogation_Position=238; Antisense; AATCAAAGAGTTGCACCACTGGTGG
>probe:Drosophila_2:1633561_at:414:73; Interrogation_Position=293; Antisense; AGGAATCGCCGCCTGCCATTGAAAG
>probe:Drosophila_2:1633561_at:191:321; Interrogation_Position=300; Antisense; GCCGCCTGCCATTGAAAGCAAGTGA
>probe:Drosophila_2:1633561_at:237:359; Interrogation_Position=54; Antisense; GCAACAACAACGCACTGTCACTGTC
>probe:Drosophila_2:1633561_at:38:259; Interrogation_Position=66; Antisense; CACTGTCACTGTCATGCATCATCAT
>probe:Drosophila_2:1633561_at:443:497; Interrogation_Position=76; Antisense; GTCATGCATCATCATCGTGGCGGAG
>probe:Drosophila_2:1633561_at:196:35; Interrogation_Position=86; Antisense; ATCATCGTGGCGGAGTTACTCGGAG

Paste this into a BLAST search page for me
GTTACTCGGAGTCTGCTGTTTGAAATTGAAAATTATTGCATGTCTCCGGGATGCTTAATGTCATGCAACAACAGCGGGCCAGCAAACTGCAACCTGCCAGAACCTGCCAGAGGAGCAGTCTGCAATGCAAAGGAGACGACTCCCAACTATACGACTCCCAACTATGCCAGATCTGAATCAAAGAGTTGCACCACTGGTGGAGGAATCGCCGCCTGCCATTGAAAGGCCGCCTGCCATTGAAAGCAAGTGAGCAACAACAACGCACTGTCACTGTCCACTGTCACTGTCATGCATCATCATGTCATGCATCATCATCGTGGCGGAGATCATCGTGGCGGAGTTACTCGGAG

Full Affymetrix probeset data:

Annotations for 1633561_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720