FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633563_at:

>probe:Drosophila_2:1633563_at:253:537; Interrogation_Position=1052; Antisense; GGTCTACTACTTTCTCAACTATGGT
>probe:Drosophila_2:1633563_at:209:529; Interrogation_Position=1074; Antisense; GGTTTAAAGCCGCTGGTATTCCAGT
>probe:Drosophila_2:1633563_at:345:227; Interrogation_Position=1102; Antisense; AATGGTTGCGTGAGGATCTGGCCAA
>probe:Drosophila_2:1633563_at:162:207; Interrogation_Position=1152; Antisense; AAGCGTCCGTGGATCATCTTGTACG
>probe:Drosophila_2:1633563_at:453:423; Interrogation_Position=1203; Antisense; GAGAACGACAATGACTGCACCCACT
>probe:Drosophila_2:1633563_at:569:523; Interrogation_Position=1247; Antisense; GGGCTGGCCATTTGTACACATGTTC
>probe:Drosophila_2:1633563_at:493:3; Interrogation_Position=1274; Antisense; ATTGGAGCCGCTGCTTTACGAGTTC
>probe:Drosophila_2:1633563_at:261:405; Interrogation_Position=1342; Antisense; GACTCTGGCCCATTTACGATTACAA
>probe:Drosophila_2:1633563_at:666:7; Interrogation_Position=1390; Antisense; ATTCGCCGTACAATGATCCTAGTGC
>probe:Drosophila_2:1633563_at:407:241; Interrogation_Position=1478; Antisense; AATACCCGAATGGAGCGCTTTTCAC
>probe:Drosophila_2:1633563_at:94:75; Interrogation_Position=1507; Antisense; AGGACTATGGTTACACACGGCTCAA
>probe:Drosophila_2:1633563_at:541:571; Interrogation_Position=1525; Antisense; GGCTCAAGGCTCACAATCGAACACA
>probe:Drosophila_2:1633563_at:54:387; Interrogation_Position=1543; Antisense; GAACACATATCCATTTCGAGCAGGT
>probe:Drosophila_2:1633563_at:241:197; Interrogation_Position=1581; Antisense; AACGGCGCCATCATCGATGACTTTT

Paste this into a BLAST search page for me
GGTCTACTACTTTCTCAACTATGGTGGTTTAAAGCCGCTGGTATTCCAGTAATGGTTGCGTGAGGATCTGGCCAAAAGCGTCCGTGGATCATCTTGTACGGAGAACGACAATGACTGCACCCACTGGGCTGGCCATTTGTACACATGTTCATTGGAGCCGCTGCTTTACGAGTTCGACTCTGGCCCATTTACGATTACAAATTCGCCGTACAATGATCCTAGTGCAATACCCGAATGGAGCGCTTTTCACAGGACTATGGTTACACACGGCTCAAGGCTCAAGGCTCACAATCGAACACAGAACACATATCCATTTCGAGCAGGTAACGGCGCCATCATCGATGACTTTT

Full Affymetrix probeset data:

Annotations for 1633563_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720