FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633565_at:

>probe:Drosophila_2:1633565_at:106:73; Interrogation_Position=2615; Antisense; AGGCAGCTTTGCGAAAGTTCTTCAA
>probe:Drosophila_2:1633565_at:346:289; Interrogation_Position=2671; Antisense; CGGCACTATAAATCGGTTCACCTAC
>probe:Drosophila_2:1633565_at:486:163; Interrogation_Position=2696; Antisense; AAATCAACGCGCTTGCCTTTGAAGA
>probe:Drosophila_2:1633565_at:217:243; Interrogation_Position=2780; Antisense; AATTTGAGACACTTCCCGCATTGGA
>probe:Drosophila_2:1633565_at:467:167; Interrogation_Position=2813; Antisense; AAATGCTGCCTGAAATGGGACCTTA
>probe:Drosophila_2:1633565_at:393:227; Interrogation_Position=2826; Antisense; AATGGGACCTTATTTCCTGGCCGAG
>probe:Drosophila_2:1633565_at:80:417; Interrogation_Position=2848; Antisense; GAGTTACCCGACGATAGCACACTTA
>probe:Drosophila_2:1633565_at:35:113; Interrogation_Position=2863; Antisense; AGCACACTTATAACGCGGCAAATGA
>probe:Drosophila_2:1633565_at:618:179; Interrogation_Position=2887; Antisense; AAACACTTTCCCATTCATTTCGCAA
>probe:Drosophila_2:1633565_at:226:17; Interrogation_Position=2903; Antisense; ATTTCGCAAGGGACGTGTTCTGTTC
>probe:Drosophila_2:1633565_at:683:551; Interrogation_Position=2928; Antisense; GGAGAATCTTCTTAACTGCGATGAA
>probe:Drosophila_2:1633565_at:700:701; Interrogation_Position=3024; Antisense; TTTTGCGCCCTTTGATTTTACAGAC
>probe:Drosophila_2:1633565_at:467:41; Interrogation_Position=3089; Antisense; ATCGGTTGTAATTGCTGAGCCCTTG
>probe:Drosophila_2:1633565_at:50:417; Interrogation_Position=3105; Antisense; GAGCCCTTGCTAACAGTTCATCCAT

Paste this into a BLAST search page for me
AGGCAGCTTTGCGAAAGTTCTTCAACGGCACTATAAATCGGTTCACCTACAAATCAACGCGCTTGCCTTTGAAGAAATTTGAGACACTTCCCGCATTGGAAAATGCTGCCTGAAATGGGACCTTAAATGGGACCTTATTTCCTGGCCGAGGAGTTACCCGACGATAGCACACTTAAGCACACTTATAACGCGGCAAATGAAAACACTTTCCCATTCATTTCGCAAATTTCGCAAGGGACGTGTTCTGTTCGGAGAATCTTCTTAACTGCGATGAATTTTGCGCCCTTTGATTTTACAGACATCGGTTGTAATTGCTGAGCCCTTGGAGCCCTTGCTAACAGTTCATCCAT

Full Affymetrix probeset data:

Annotations for 1633565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720