FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633566_at:

>probe:Drosophila_2:1633566_at:395:437; Interrogation_Position=451; Antisense; GAGGAGAACTGCCATGTCCGACTAC
>probe:Drosophila_2:1633566_at:456:503; Interrogation_Position=466; Antisense; GTCCGACTACTTCGAGGAACTGGGT
>probe:Drosophila_2:1633566_at:155:127; Interrogation_Position=505; Antisense; ACCACTGGGCGCAAACGATTTGGCC
>probe:Drosophila_2:1633566_at:286:579; Interrogation_Position=526; Antisense; GGCCAGAAATCTAAAGCGCCTTCAG
>probe:Drosophila_2:1633566_at:527:315; Interrogation_Position=543; Antisense; GCCTTCAGGTTTTGGCCATCATGAA
>probe:Drosophila_2:1633566_at:637:97; Interrogation_Position=582; Antisense; AGATCGAGGTGCCAGAGGCCTCCAA
>probe:Drosophila_2:1633566_at:96:207; Interrogation_Position=605; Antisense; AAGCGAGCCATTCTGGAGCTACCAG
>probe:Drosophila_2:1633566_at:194:553; Interrogation_Position=619; Antisense; GGAGCTACCAGTTCATGAAATCGTC
>probe:Drosophila_2:1633566_at:416:327; Interrogation_Position=660; Antisense; GCGATTTGGAGTGCTCTGTGTGCAA
>probe:Drosophila_2:1633566_at:661:89; Interrogation_Position=708; Antisense; AGTACAGGATCCTTCCATGCAAGCA
>probe:Drosophila_2:1633566_at:588:137; Interrogation_Position=732; Antisense; ACGAGTTCCACGAGGAGTGCATCCT
>probe:Drosophila_2:1633566_at:383:109; Interrogation_Position=768; Antisense; AGAAGACGAATTCCTGTCCTCTGTG
>probe:Drosophila_2:1633566_at:204:599; Interrogation_Position=782; Antisense; TGTCCTCTGTGTCGCTATGAACTGG
>probe:Drosophila_2:1633566_at:437:527; Interrogation_Position=873; Antisense; GGGAGAACACTCTTTTGGATTCCAT

Paste this into a BLAST search page for me
GAGGAGAACTGCCATGTCCGACTACGTCCGACTACTTCGAGGAACTGGGTACCACTGGGCGCAAACGATTTGGCCGGCCAGAAATCTAAAGCGCCTTCAGGCCTTCAGGTTTTGGCCATCATGAAAGATCGAGGTGCCAGAGGCCTCCAAAAGCGAGCCATTCTGGAGCTACCAGGGAGCTACCAGTTCATGAAATCGTCGCGATTTGGAGTGCTCTGTGTGCAAAGTACAGGATCCTTCCATGCAAGCAACGAGTTCCACGAGGAGTGCATCCTAGAAGACGAATTCCTGTCCTCTGTGTGTCCTCTGTGTCGCTATGAACTGGGGGAGAACACTCTTTTGGATTCCAT

Full Affymetrix probeset data:

Annotations for 1633566_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720