Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633574_at:

>probe:Drosophila_2:1633574_at:717:3; Interrogation_Position=124; Antisense; ATTTATAACCTATCCTCCCGAAGAT
>probe:Drosophila_2:1633574_at:624:47; Interrogation_Position=135; Antisense; ATCCTCCCGAAGATGTGTTGCCAAG
>probe:Drosophila_2:1633574_at:119:309; Interrogation_Position=155; Antisense; CCAAGGAGCTTGTGGATCGGTATCC
>probe:Drosophila_2:1633574_at:701:41; Interrogation_Position=170; Antisense; ATCGGTATCCTATGCCCTGGCTTAT
>probe:Drosophila_2:1633574_at:126:339; Interrogation_Position=210; Antisense; GCTCTGCCAGCCATGAACTATAATA
>probe:Drosophila_2:1633574_at:193:631; Interrogation_Position=22; Antisense; TCCGTACGCTTTCACCAGTACATAA
>probe:Drosophila_2:1633574_at:598:655; Interrogation_Position=230; Antisense; TAATAACTGCTGCTGTGGACCCAAT
>probe:Drosophila_2:1633574_at:190:585; Interrogation_Position=270; Antisense; TGGACATGTCCTCCTAACAGGTGCT
>probe:Drosophila_2:1633574_at:310:189; Interrogation_Position=285; Antisense; AACAGGTGCTGTTGTGCCGGCGAAT
>probe:Drosophila_2:1633574_at:384:467; Interrogation_Position=313; Antisense; GTTGCTTTGGGCCTTTTTACTGAGA
>probe:Drosophila_2:1633574_at:647:377; Interrogation_Position=336; Antisense; GAAACCCAAGGTACGACAATTCCTG
>probe:Drosophila_2:1633574_at:327:539; Interrogation_Position=393; Antisense; GGTTTGAACCACATTTTCACTTACA
>probe:Drosophila_2:1633574_at:18:159; Interrogation_Position=415; Antisense; ACACAATGGTTCGAGCTTTTCAATA
>probe:Drosophila_2:1633574_at:493:207; Interrogation_Position=99; Antisense; AAGCATTTCTCTTGCCTTAAACAAA

Paste this into a BLAST search page for me
ATTTATAACCTATCCTCCCGAAGATATCCTCCCGAAGATGTGTTGCCAAGCCAAGGAGCTTGTGGATCGGTATCCATCGGTATCCTATGCCCTGGCTTATGCTCTGCCAGCCATGAACTATAATATCCGTACGCTTTCACCAGTACATAATAATAACTGCTGCTGTGGACCCAATTGGACATGTCCTCCTAACAGGTGCTAACAGGTGCTGTTGTGCCGGCGAATGTTGCTTTGGGCCTTTTTACTGAGAGAAACCCAAGGTACGACAATTCCTGGGTTTGAACCACATTTTCACTTACAACACAATGGTTCGAGCTTTTCAATAAAGCATTTCTCTTGCCTTAAACAAA

Full Affymetrix probeset data:

Annotations for 1633574_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime