FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633579_at:

>probe:Drosophila_2:1633579_at:278:449; Interrogation_Position=439; Antisense; GATCCATCTGTACATCAATTCGCCC
>probe:Drosophila_2:1633579_at:535:9; Interrogation_Position=456; Antisense; ATTCGCCCGGCGGTGTTGTTACAGC
>probe:Drosophila_2:1633579_at:194:601; Interrogation_Position=472; Antisense; TGTTACAGCGGGTTTGGCGATCTAC
>probe:Drosophila_2:1633579_at:529:575; Interrogation_Position=487; Antisense; GGCGATCTACGATACGATGCAGTAC
>probe:Drosophila_2:1633579_at:94:495; Interrogation_Position=512; Antisense; GTCAAGCCACCCATTGCAACTTGGT
>probe:Drosophila_2:1633579_at:242:191; Interrogation_Position=529; Antisense; AACTTGGTGCGTTGGACAGGCCTGC
>probe:Drosophila_2:1633579_at:300:657; Interrogation_Position=621; Antisense; TAATGATACATCAGCCCTCTGGTGG
>probe:Drosophila_2:1633579_at:690:69; Interrogation_Position=652; Antisense; AGGCCAAGCCACAGACATCCTAATA
>probe:Drosophila_2:1633579_at:254:309; Interrogation_Position=706; Antisense; CCAGCTGACCAACATCTACGTGAAG
>probe:Drosophila_2:1633579_at:344:219; Interrogation_Position=804; Antisense; AAGTGCTGGGCATCATTGACCACGT
>probe:Drosophila_2:1633579_at:279:7; Interrogation_Position=818; Antisense; ATTGACCACGTGCTTGAACATCCTC
>probe:Drosophila_2:1633579_at:507:47; Interrogation_Position=837; Antisense; ATCCTCCAGAGACTGTTTCCGAAAC
>probe:Drosophila_2:1633579_at:537:207; Interrogation_Position=932; Antisense; AAGCAGGCAGCCTAAATTTCCACCT
>probe:Drosophila_2:1633579_at:515:695; Interrogation_Position=948; Antisense; TTTCCACCTTCCTATAGACCAAAAT

Paste this into a BLAST search page for me
GATCCATCTGTACATCAATTCGCCCATTCGCCCGGCGGTGTTGTTACAGCTGTTACAGCGGGTTTGGCGATCTACGGCGATCTACGATACGATGCAGTACGTCAAGCCACCCATTGCAACTTGGTAACTTGGTGCGTTGGACAGGCCTGCTAATGATACATCAGCCCTCTGGTGGAGGCCAAGCCACAGACATCCTAATACCAGCTGACCAACATCTACGTGAAGAAGTGCTGGGCATCATTGACCACGTATTGACCACGTGCTTGAACATCCTCATCCTCCAGAGACTGTTTCCGAAACAAGCAGGCAGCCTAAATTTCCACCTTTTCCACCTTCCTATAGACCAAAAT

Full Affymetrix probeset data:

Annotations for 1633579_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720