Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633580_at:

>probe:Drosophila_2:1633580_at:221:433; Interrogation_Position=1413; Antisense; GAGTGAATTCGATCCATCCAGCAGC
>probe:Drosophila_2:1633580_at:351:591; Interrogation_Position=1448; Antisense; TGGTCAGTCGCTGTGCCGTGGTCAA
>probe:Drosophila_2:1633580_at:118:653; Interrogation_Position=1469; Antisense; TCAAGCCGCTCAAGTTTCGCCTTTG
>probe:Drosophila_2:1633580_at:148:89; Interrogation_Position=1514; Antisense; AGTCGAGTAACCAGCAGCGGCGCAA
>probe:Drosophila_2:1633580_at:301:207; Interrogation_Position=1547; Antisense; AAGCGGCGGCCAAGAATCAACAGTC
>probe:Drosophila_2:1633580_at:76:155; Interrogation_Position=1566; Antisense; ACAGTCCAGTGGAGTGGCCAGCAAA
>probe:Drosophila_2:1633580_at:309:143; Interrogation_Position=1641; Antisense; ACTGGAGCCGGCCATACCGAAGACA
>probe:Drosophila_2:1633580_at:530:375; Interrogation_Position=1659; Antisense; GAAGACACCGAAGCCCAGGGATCCG
>probe:Drosophila_2:1633580_at:337:595; Interrogation_Position=1739; Antisense; TGGGCCTGATCATGGGCAGCTTCAT
>probe:Drosophila_2:1633580_at:700:591; Interrogation_Position=1799; Antisense; TGGTGCCGGCATGTAGCAGCCATTG
>probe:Drosophila_2:1633580_at:292:113; Interrogation_Position=1813; Antisense; AGCAGCCATTGCAACATACCGGAAT
>probe:Drosophila_2:1633580_at:232:525; Interrogation_Position=1863; Antisense; GGGCTACATGAATTCGGCGCTCAAT
>probe:Drosophila_2:1633580_at:479:579; Interrogation_Position=1890; Antisense; GGCCATCTATACCATCTTCAACAAG
>probe:Drosophila_2:1633580_at:586:35; Interrogation_Position=1903; Antisense; ATCTTCAACAAGGACTTCCGACGCG

Paste this into a BLAST search page for me
GAGTGAATTCGATCCATCCAGCAGCTGGTCAGTCGCTGTGCCGTGGTCAATCAAGCCGCTCAAGTTTCGCCTTTGAGTCGAGTAACCAGCAGCGGCGCAAAAGCGGCGGCCAAGAATCAACAGTCACAGTCCAGTGGAGTGGCCAGCAAAACTGGAGCCGGCCATACCGAAGACAGAAGACACCGAAGCCCAGGGATCCGTGGGCCTGATCATGGGCAGCTTCATTGGTGCCGGCATGTAGCAGCCATTGAGCAGCCATTGCAACATACCGGAATGGGCTACATGAATTCGGCGCTCAATGGCCATCTATACCATCTTCAACAAGATCTTCAACAAGGACTTCCGACGCG

Full Affymetrix probeset data:

Annotations for 1633580_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime