Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633581_at:

>probe:Drosophila_2:1633581_at:264:685; Interrogation_Position=1024; Antisense; TATCTGCCCGTGAAGCCGGTGAGGA
>probe:Drosophila_2:1633581_at:181:155; Interrogation_Position=473; Antisense; ACAGTGCTCCCGAGGATCACGATGA
>probe:Drosophila_2:1633581_at:231:353; Interrogation_Position=498; Antisense; GCAGCAGATCGTGCGCTATGTGAAT
>probe:Drosophila_2:1633581_at:643:523; Interrogation_Position=525; Antisense; GGGCAGGCCCCAGAAGAACTACCGT
>probe:Drosophila_2:1633581_at:223:385; Interrogation_Position=540; Antisense; GAACTACCGTGTGGTCTTCATCAAC
>probe:Drosophila_2:1633581_at:715:421; Interrogation_Position=622; Antisense; GAGAAGACTGCCATCTATGTCCTGT
>probe:Drosophila_2:1633581_at:562:679; Interrogation_Position=637; Antisense; TATGTCCTGTCCAAGAAGTCTAATG
>probe:Drosophila_2:1633581_at:592:217; Interrogation_Position=652; Antisense; AAGTCTAATGCCCTGGATGTCACCG
>probe:Drosophila_2:1633581_at:137:115; Interrogation_Position=764; Antisense; AGCAGACCATTCAGGCCAACTATGA
>probe:Drosophila_2:1633581_at:162:53; Interrogation_Position=788; Antisense; ATGCTCTGGGTGGAAGCTCTGAGAC
>probe:Drosophila_2:1633581_at:258:263; Interrogation_Position=815; Antisense; GCAACGAGGGTGTGATTCCCGTTTC
>probe:Drosophila_2:1633581_at:136:65; Interrogation_Position=866; Antisense; ATGGAGCCTCCGGAGTGTTGACCGA
>probe:Drosophila_2:1633581_at:529:293; Interrogation_Position=888; Antisense; CGATGCCAGCGGTAGCGTGAACATT
>probe:Drosophila_2:1633581_at:581:469; Interrogation_Position=928; Antisense; GTTCCAACCGTGGATGCTGGAGCCA

Paste this into a BLAST search page for me
TATCTGCCCGTGAAGCCGGTGAGGAACAGTGCTCCCGAGGATCACGATGAGCAGCAGATCGTGCGCTATGTGAATGGGCAGGCCCCAGAAGAACTACCGTGAACTACCGTGTGGTCTTCATCAACGAGAAGACTGCCATCTATGTCCTGTTATGTCCTGTCCAAGAAGTCTAATGAAGTCTAATGCCCTGGATGTCACCGAGCAGACCATTCAGGCCAACTATGAATGCTCTGGGTGGAAGCTCTGAGACGCAACGAGGGTGTGATTCCCGTTTCATGGAGCCTCCGGAGTGTTGACCGACGATGCCAGCGGTAGCGTGAACATTGTTCCAACCGTGGATGCTGGAGCCA

Full Affymetrix probeset data:

Annotations for 1633581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime