FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633583_at:

>probe:Drosophila_2:1633583_at:701:249; Interrogation_Position=3230; Antisense; CAATGTGGCCGGGATCTACTACATC
>probe:Drosophila_2:1633583_at:665:667; Interrogation_Position=3246; Antisense; TACTACATCCTAATCGGAGGCCTGC
>probe:Drosophila_2:1633583_at:498:513; Interrogation_Position=3279; Antisense; GTGATTGTGGCCATCATGGAGTTCT
>probe:Drosophila_2:1633583_at:205:67; Interrogation_Position=3294; Antisense; ATGGAGTTCTTCTGCCGCAACAAAA
>probe:Drosophila_2:1633583_at:665:297; Interrogation_Position=3322; Antisense; CGCAGCTAAAGTCGCCAGGATCCAA
>probe:Drosophila_2:1633583_at:296:333; Interrogation_Position=3374; Antisense; GCTGGCCTCCTCAACATATCAAAGG
>probe:Drosophila_2:1633583_at:211:11; Interrogation_Position=3400; Antisense; ATTCCCTTTCCGATGCGATTATGCA
>probe:Drosophila_2:1633583_at:620:705; Interrogation_Position=3418; Antisense; TTATGCATTCGCAGGCCAAGTTGGC
>probe:Drosophila_2:1633583_at:570:295; Interrogation_Position=3451; Antisense; CGAGCAGCGAGTATGACGAGCGATT
>probe:Drosophila_2:1633583_at:184:95; Interrogation_Position=3487; Antisense; AGTTGGCCTCGAACGTGCGGTATCA
>probe:Drosophila_2:1633583_at:55:345; Interrogation_Position=3517; Antisense; GCATGTAAGAAACCCGCTCGTTCAC
>probe:Drosophila_2:1633583_at:549:223; Interrogation_Position=3591; Antisense; AAGGCATAACTAAACGACGCTGGCA
>probe:Drosophila_2:1633583_at:88:285; Interrogation_Position=3610; Antisense; CTGGCAATCAACTCTCGGGTCAAAA
>probe:Drosophila_2:1633583_at:174:687; Interrogation_Position=3730; Antisense; TATAGCTACGACTACCACTACAACT

Paste this into a BLAST search page for me
CAATGTGGCCGGGATCTACTACATCTACTACATCCTAATCGGAGGCCTGCGTGATTGTGGCCATCATGGAGTTCTATGGAGTTCTTCTGCCGCAACAAAACGCAGCTAAAGTCGCCAGGATCCAAGCTGGCCTCCTCAACATATCAAAGGATTCCCTTTCCGATGCGATTATGCATTATGCATTCGCAGGCCAAGTTGGCCGAGCAGCGAGTATGACGAGCGATTAGTTGGCCTCGAACGTGCGGTATCAGCATGTAAGAAACCCGCTCGTTCACAAGGCATAACTAAACGACGCTGGCACTGGCAATCAACTCTCGGGTCAAAATATAGCTACGACTACCACTACAACT

Full Affymetrix probeset data:

Annotations for 1633583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720