Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633584_at:

>probe:Drosophila_2:1633584_at:432:225; Interrogation_Position=1234; Antisense; AAGGCGATACGTTGGCTGCATTGGA
>probe:Drosophila_2:1633584_at:201:579; Interrogation_Position=1263; Antisense; GGCCATTACTGCGAAGCTTTACCTG
>probe:Drosophila_2:1633584_at:464:697; Interrogation_Position=1280; Antisense; TTTACCTGCTCTATGTGGACACTGT
>probe:Drosophila_2:1633584_at:254:555; Interrogation_Position=1296; Antisense; GGACACTGTTTCACCATTTGACCGT
>probe:Drosophila_2:1633584_at:456:571; Interrogation_Position=1351; Antisense; GGCGGGCTCAATACTGAAAACCTTT
>probe:Drosophila_2:1633584_at:178:65; Interrogation_Position=1377; Antisense; ATGGATTCGCCAAGTACTTCTTCGG
>probe:Drosophila_2:1633584_at:510:617; Interrogation_Position=1403; Antisense; TGCACGGATTGCTCTGAACACTTTC
>probe:Drosophila_2:1633584_at:149:387; Interrogation_Position=1418; Antisense; GAACACTTTCAGCAGATGGCCATTC
>probe:Drosophila_2:1633584_at:279:439; Interrogation_Position=1432; Antisense; GATGGCCATTCGTCGTAATCTGACT
>probe:Drosophila_2:1633584_at:169:595; Interrogation_Position=1493; Antisense; TGGGCAGCCCACAACGAAGTCAATG
>probe:Drosophila_2:1633584_at:648:53; Interrogation_Position=1515; Antisense; ATGCACGCATTGCTGGAGACTCTAC
>probe:Drosophila_2:1633584_at:273:549; Interrogation_Position=1540; Antisense; GGAGGATCCCAAGTTCCCGAAGATT
>probe:Drosophila_2:1633584_at:695:461; Interrogation_Position=1561; Antisense; GATTCAGTTCCCCAGCGCGGAGAAT
>probe:Drosophila_2:1633584_at:306:49; Interrogation_Position=1668; Antisense; ATGTAAGCTTTTATGGCCTTCCCAC

Paste this into a BLAST search page for me
AAGGCGATACGTTGGCTGCATTGGAGGCCATTACTGCGAAGCTTTACCTGTTTACCTGCTCTATGTGGACACTGTGGACACTGTTTCACCATTTGACCGTGGCGGGCTCAATACTGAAAACCTTTATGGATTCGCCAAGTACTTCTTCGGTGCACGGATTGCTCTGAACACTTTCGAACACTTTCAGCAGATGGCCATTCGATGGCCATTCGTCGTAATCTGACTTGGGCAGCCCACAACGAAGTCAATGATGCACGCATTGCTGGAGACTCTACGGAGGATCCCAAGTTCCCGAAGATTGATTCAGTTCCCCAGCGCGGAGAATATGTAAGCTTTTATGGCCTTCCCAC

Full Affymetrix probeset data:

Annotations for 1633584_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime