Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633586_at:

>probe:Drosophila_2:1633586_at:416:203; Interrogation_Position=136; Antisense; AAGCGAACCTGGACCGTAGATCCCA
>probe:Drosophila_2:1633586_at:413:677; Interrogation_Position=152; Antisense; TAGATCCCAACAAGACAGTCGGCTG
>probe:Drosophila_2:1633586_at:93:267; Interrogation_Position=167; Antisense; CAGTCGGCTGGATACAGACGTTCAT
>probe:Drosophila_2:1633586_at:707:103; Interrogation_Position=182; Antisense; AGACGTTCATCCACAAGTTTCTGAA
>probe:Drosophila_2:1633586_at:66:93; Interrogation_Position=197; Antisense; AGTTTCTGAAACTCGATGCCAGCGA
>probe:Drosophila_2:1633586_at:572:355; Interrogation_Position=222; Antisense; GCAAATTGCACACATTTGCACCTGC
>probe:Drosophila_2:1633586_at:253:131; Interrogation_Position=241; Antisense; ACCTGCCCCGGATCAGATAATCAAG
>probe:Drosophila_2:1633586_at:346:385; Interrogation_Position=265; Antisense; GAACTTGTACGAGTGCCATGGAACC
>probe:Drosophila_2:1633586_at:299:229; Interrogation_Position=290; Antisense; AATGGGAAACTGGTGCTCTACTACT
>probe:Drosophila_2:1633586_at:679:591; Interrogation_Position=300; Antisense; TGGTGCTCTACTACTGCAAGAATCA
>probe:Drosophila_2:1633586_at:296:237; Interrogation_Position=337; Antisense; AATCGATACGCACATGACTTTGCTA
>probe:Drosophila_2:1633586_at:392:341; Interrogation_Position=55; Antisense; GCATTCGTTTTATCACAAAGACTTG
>probe:Drosophila_2:1633586_at:44:403; Interrogation_Position=74; Antisense; GACTTGCTTCATTATCAGTTTGTAT
>probe:Drosophila_2:1633586_at:55:91; Interrogation_Position=90; Antisense; AGTTTGTATCCTTCTGAACGCCACT

Paste this into a BLAST search page for me
AAGCGAACCTGGACCGTAGATCCCATAGATCCCAACAAGACAGTCGGCTGCAGTCGGCTGGATACAGACGTTCATAGACGTTCATCCACAAGTTTCTGAAAGTTTCTGAAACTCGATGCCAGCGAGCAAATTGCACACATTTGCACCTGCACCTGCCCCGGATCAGATAATCAAGGAACTTGTACGAGTGCCATGGAACCAATGGGAAACTGGTGCTCTACTACTTGGTGCTCTACTACTGCAAGAATCAAATCGATACGCACATGACTTTGCTAGCATTCGTTTTATCACAAAGACTTGGACTTGCTTCATTATCAGTTTGTATAGTTTGTATCCTTCTGAACGCCACT

Full Affymetrix probeset data:

Annotations for 1633586_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime