Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1633589_a_at:

>probe:Drosophila_2:1633589_a_at:126:637; Interrogation_Position=243; Antisense; TCGTCCTTTTGAGCCTGTGCTCGAA
>probe:Drosophila_2:1633589_a_at:537:597; Interrogation_Position=258; Antisense; TGTGCTCGAATCTCTTCTGCGAGAA
>probe:Drosophila_2:1633589_a_at:672:421; Interrogation_Position=278; Antisense; GAGAACAATCACATAATGCCCCGTT
>probe:Drosophila_2:1633589_a_at:104:623; Interrogation_Position=380; Antisense; TGCTGTCCGGTTTATTGCAACCTGA
>probe:Drosophila_2:1633589_a_at:109:203; Interrogation_Position=398; Antisense; AACCTGAAGCGTCGGATGCAGCGCC
>probe:Drosophila_2:1633589_a_at:335:255; Interrogation_Position=460; Antisense; CAAACAGGACGGCTCAGCGGGATCC
>probe:Drosophila_2:1633589_a_at:330:591; Interrogation_Position=502; Antisense; TGGTGGCGACGGTCCCAATAACTCG
>probe:Drosophila_2:1633589_a_at:344:31; Interrogation_Position=519; Antisense; ATAACTCGCTCCTCAGTGAGTTTGT
>probe:Drosophila_2:1633589_a_at:679:443; Interrogation_Position=560; Antisense; GATGACAGGATGGTTTTGCTCGGCA
>probe:Drosophila_2:1633589_a_at:22:703; Interrogation_Position=573; Antisense; TTTTGCTCGGCAGGATGGCCAACTA
>probe:Drosophila_2:1633589_a_at:435:69; Interrogation_Position=587; Antisense; ATGGCCAACTAGGACGACGCGACGA
>probe:Drosophila_2:1633589_a_at:234:713; Interrogation_Position=635; Antisense; TTCTGCGATTTGTGAACCAACCGGT
>probe:Drosophila_2:1633589_a_at:425:169; Interrogation_Position=673; Antisense; AAAGGAAGTCGCGTCACCGCAACAC
>probe:Drosophila_2:1633589_a_at:675:685; Interrogation_Position=782; Antisense; TATAAGCTGGTATTCATCAAACTGA

Paste this into a BLAST search page for me
TCGTCCTTTTGAGCCTGTGCTCGAATGTGCTCGAATCTCTTCTGCGAGAAGAGAACAATCACATAATGCCCCGTTTGCTGTCCGGTTTATTGCAACCTGAAACCTGAAGCGTCGGATGCAGCGCCCAAACAGGACGGCTCAGCGGGATCCTGGTGGCGACGGTCCCAATAACTCGATAACTCGCTCCTCAGTGAGTTTGTGATGACAGGATGGTTTTGCTCGGCATTTTGCTCGGCAGGATGGCCAACTAATGGCCAACTAGGACGACGCGACGATTCTGCGATTTGTGAACCAACCGGTAAAGGAAGTCGCGTCACCGCAACACTATAAGCTGGTATTCATCAAACTGA

Full Affymetrix probeset data:

Annotations for 1633589_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime